miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-506-3p | ||||
| miRNA Stemloop AC | MI0003193 | ||||
| miRNA Stemloop ID | hsa-mir-506 | ||||
| Sequence | uaaggcacccuucugaguaga | ||||
| TTD Target(s) Regulated by This miRNA | Cyclin-dependent kinase 4 (CDK4) | Successful Target | Target Info | [1] | |
| Cyclin-dependent kinase 6 (CDK6) | Successful Target | Target Info | [2] | ||
| Rho-associated protein kinase 1 (ROCK1) | Successful Target | Target Info | [3] | ||
| Sphingosine kinase 1 (SPHK1) | Clinical trial Target | Target Info | [4] | ||
| Neural cadherin (CDH2) | Clinical trial Target | Target Info | [5] | ||
| PIM-3 protein kinase (PIM3) | Patented-recorded Target | Target Info | [6] | ||
| Protein C-ets-1 (ETS1) | Literature-reported Target | Target Info | [7] | ||
| Yes-associated protein 1 (YAP1) | Literature-reported Target | Target Info | [8] | ||
| Forkhead box protein Q1 (FOXQ1) | Literature-reported Target | Target Info | [9] | ||
| Protein(s) Regulated by This miRNA | CD151 antigen | Regulated Protein | [10] | ||
| Coactosin-like protein | Regulated Protein | [11] | |||
| Flotillin-1 | Regulated Protein | [12] | |||
| Frataxin, mitochondrial | Regulated Protein | [13] | |||
| Ras GTPase-activating-like protein IQGAP1 | Regulated Protein | [14] | |||
| Serine/threonine-protein kinase WNK1 | Regulated Protein | [15] | |||
| Transcription factor E2-alpha | Regulated Protein | [16] | |||
| Transcriptional activator GLI3 | Regulated Protein | [17] | |||
| Vimentin | Regulated Protein | [10] | |||
| Zinc finger protein SNAI1 | Regulated Protein | [18] | |||
| Zinc finger protein SNAI2 | Regulated Protein | [19] | |||
| References | |||||
| REF 1 | Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41. | ||||
| REF 2 | MiR-506 suppresses proliferation and induces senescence by directly targeting the CDK4/6-FOXM1 axis in ovarian cancer. J Pathol. 2014 Jul;233(3):308-18. | ||||
| REF 3 | MiR-506 suppresses cell proliferation and tumor growth by targeting Rho-associated protein kinase 1 in hepatocellular carcinoma. Biochem Biophys Res Commun. 2015 Nov 27;467(4):921-7. | ||||
| REF 4 | MiR-506 suppresses liver cancer angiogenesis through targeting sphingosine kinase 1 (SPHK1) mRNA. Biochem Biophys Res Commun. 2015 Dec 4-11;468(1-2):8-13. | ||||
| REF 5 | MiR-506 inhibits multiple targets in the epithelial-to-mesenchymal transition network and is associated with good prognosis in epithelial ovarian cancer. J Pathol. 2015 Jan;235(1):25-36. | ||||
| REF 6 | MicroRNA 06 participates in pancreatic cancer pathogenesis by targeting PIM3. Mol Med Rep. 2015 Oct;12(4):5121-6. | ||||
| REF 7 | miR-506 Inhibits Epithelial-to-Mesenchymal Transition and Angiogenesis in Gastric Cancer. Am J Pathol. 2015 Sep;185(9):2412-20. | ||||
| REF 8 | MicroRNA-506 inhibits gastric cancer proliferation and invasion by directly targeting Yap1. Tumour Biol. 2015 Sep;36(9):6823-31. | ||||
| REF 9 | MiR-506 suppresses tumor proliferation and invasion by targeting FOXQ1 in nasopharyngeal carcinoma. PLoS One. 2015 Apr 9;10(4):e0122851. | ||||
| REF 10 | miR-506 regulates epithelial mesenchymal transition in breast cancer cell lines.PLoS One. 2013 May 22;8(5):e64273. | ||||
| REF 11 | Genetic and epigenetic silencing of mircoRNA-506-3p enhances COTL1 oncogene expression to foster non-small lung cancer progression.Oncotarget. 2017 Jan 3;8(1):644-657. | ||||
| REF 12 | MiR-506 is down-regulated in clear cell renal cell carcinoma and inhibits cell growth and metastasis via targeting FLOT1.PLoS One. 2015 Mar 20;10(3):e0120258. | ||||
| REF 13 | Genetic variations creating microRNA target sites in the FXN 3'-UTR affect frataxin expression in Friedreich ataxia.PLoS One. 2013;8(1):e54791. | ||||
| REF 14 | miR-506 regulates breast cancer cell metastasis by targeting IQGAP1.Int J Oncol. 2015 Nov;47(5):1963-70. | ||||
| REF 15 | Selective killing of lung cancer cells by miRNA-506 molecule through inhibiting NF-B p65 to evoke reactive oxygen species generation and p53 activation.Oncogene. 2015 Feb 5;34(6):691-703. | ||||
| REF 16 | MicroRNA-506-3p regulates neural stem cell proliferation and differentiation through targeting TCF3.Gene. 2016 Nov 15;593(1):193-200. | ||||
| REF 17 | miR-506 acts as a tumor suppressor by directly targeting the hedgehog pathway transcription factor Gli3 in human cervical cancer.Oncogene. 2015 Feb 5;34(6):717-25. | ||||
| REF 18 | Integrated analyses identify a master microRNA regulatory network for the mesenchymal subtype in serous ovarian cancer.Cancer Cell. 2013 Feb 11;23(2):186-99. | ||||
| REF 19 | The miR-506-Induced Epithelial-Mesenchymal Transition is Involved in Poor Prognosis for Patients with Gastric Cancer.Ann Surg Oncol. 2015 Dec;22 Suppl 3:S1436-43. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.