miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-532-5p | ||||
| miRNA Stemloop AC | MI0003205 | ||||
| miRNA Stemloop ID | hsa-mir-532 | ||||
| Sequence | caugccuugaguguaggaccgu | ||||
| TTD Target(s) Regulated by This miRNA | Tyrosine-protein kinase SYK (SYK) | Successful Target | Target Info | [1] | |
| Fatty acid synthase (FASN) | Successful Target | Target Info | [1] | ||
| Telomerase reverse transcriptase (TERT) | Clinical trial Target | Target Info | [2] | ||
| C-X-C motif chemokine 2 (CXCL2) | Clinical trial Target | Target Info | [3] | ||
| Runt-related transcription factor 3 (RUNX3) | Literature-reported Target | Target Info | [4] | ||
| Protein(s) Regulated by This miRNA | Protein naked cuticle homolog 1 | Regulated Protein | [5] | ||
| Trafficking protein particle complex subunit 2B | Regulated Protein | [6] | |||
| References | |||||
| REF 1 | Computational and in vitro Investigation of miRNA-Gene Regulations in Retinoblastoma Pathogenesis: miRNA Mimics Strategy. Bioinform Biol Insights. 2015 May 12;9:89-101. | ||||
| REF 2 | MicroRNA-532 and microRNA-3064 inhibit cell proliferation and invasion by acting as direct regulators of human telomerase reverse transcriptase in ovarian cancer. PLoS One. 2017 Mar 14;12(3):e0173912. | ||||
| REF 3 | Loss of miR-532-5p in vitro promotes cell proliferation and metastasis by influencing CXCL2 expression in HCC. Am J Transl Res. 2015 Nov 15;7(11):2254-61. | ||||
| REF 4 | Regulation of RUNX3 tumor suppressor gene expression in cutaneous melanoma. Clin Cancer Res. 2009 May 1;15(9):2988-94. | ||||
| REF 5 | miR-532 promoted gastric cancer migration and invasion by targeting NKD1.Life Sci. 2017 May 15;177:15-19. | ||||
| REF 6 | MicroRNAs are differentially expressed in ulcerative colitis and alter expression of macrophage inflammatory peptide-2 alpha.Gastroenterology. 2008 Nov;135(5):1624-1635.e24. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.