miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-574-3p | ||||
| miRNA Stemloop AC | MI0003581 | ||||
| miRNA Stemloop ID | hsa-mir-574 | ||||
| Sequence | cacgcucaugcacacacccaca | ||||
| TTD Target(s) Regulated by This miRNA | Epidermal growth factor receptor (EGFR) | Successful Target | Target Info | [1] | |
| Retinoic acid receptor RXR-alpha (RXRA) | Successful Target | Target Info | [2] | ||
| Transforming growth factor beta 1 (TGFB1) | Successful Target | Target Info | [3] | ||
| Ras-related C3 botulinum toxin substrate 1 (RAC1) | Literature-reported Target | Target Info | [1] | ||
| Histone acetyltransferase p300 (EP300) | Clinical trial Target | Target Info | [1] | ||
| Protein(s) Regulated by This miRNA | Clathrin heavy chain 1 | Regulated Protein | [4] | ||
| Cullin-2 | Regulated Protein | [5] | |||
| Mothers against decapentaplegic homolog 4 | Regulated Protein | [6] | |||
| References | |||||
| REF 1 | Genistein up-regulates tumor suppressor microRNA-574-3p in prostate cancer. PLoS One. 2013;8(3):e58929. | ||||
| REF 2 | Sox9-regulated miRNA-574-3p inhibits chondrogenic differentiation of mesenchymal stem cells. PLoS One. 2013 Apr 23;8(4):e62582. | ||||
| REF 3 | Upregulation of microRNA-574-3p in a human gastric cancer cell line AGS by TGF-1. Gene. 2017 Mar 20;605:63-69. | ||||
| REF 4 | MicroRNA-574-3p, identified by microRNA library-based functional screening, modulates tamoxifen response in breast cancer.Sci Rep. 2015 Jan 6;5:7641. | ||||
| REF 5 | Aberrant expression of microRNAs in gastric cancer and biological significance of miR-574-3p.Int Immunopharmacol. 2012 Aug;13(4):468-75. | ||||
| REF 6 | miR-574-3p acts as a tumor promoter in osteosarcoma by targeting SMAD4 signaling pathway.Oncol Lett. 2016 Dec;12(6):5247-5253. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.