miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-625-5p | ||||
| miRNA Stemloop AC | MI0003639 | ||||
| miRNA Stemloop ID | hsa-mir-625 | ||||
| Sequence | agggggaaaguucuauagucc | ||||
| TTD Target(s) Regulated by This miRNA | NT-3 growth factor receptor (TrkC) | Successful Target | Target Info | [1] | |
| Fragile histidine triad protein (FHIT) | Successful Target | Target Info | [2] | ||
| Integrin-linked protein kinase 1 (ILK) | Patented-recorded Target | Target Info | [3] | ||
| High mobility group protein HMG-I/Y (HMGA1) | Literature-reported Target | Target Info | [4] | ||
| Transcription factor SOX-2 (SOX2) | Literature-reported Target | Target Info | [5] | ||
| Protein(s) Regulated by This miRNA | Insulin-like growth factor 2 mRNA-binding protein 1 | Regulated Protein | [6] | ||
| Protein SCAI | Regulated Protein | [7] | |||
| References | |||||
| REF 1 | The interplay between microRNAs and the neurotrophin receptor tropomyosin-related kinase C controls proliferation of human neuroblastoma cells. Proc Natl Acad Sci U S A. 2007 May 8;104(19):7957-62. | ||||
| REF 2 | microRNA-143 protects cells from DNA damage-induced killing by downregulating FHIT expression. Cancer Biother Radiopharm. 2011 Jun;26(3):365-72. | ||||
| REF 3 | Down-regulated miR-625 suppresses invasion and metastasis of gastric cancer by targeting ILK. FEBS Lett. 2012 Jul 30;586(16):2382-8. | ||||
| REF 4 | miR-625 suppresses cell proliferation and migration by targeting HMGA1 in breast cancer. Biochem Biophys Res Commun. 2016 Feb 19;470(4):838-44. | ||||
| REF 5 | miR-625 down-regulation promotes proliferation and invasion in esophageal cancer by targeting Sox2. FEBS Lett. 2014 Mar 18;588(6):915-21. | ||||
| REF 6 | miR-625 suppresses tumour migration and invasion by targeting IGF2BP1 in hepatocellular carcinoma.Oncogene. 2015 Feb 19;34(8):965-77. | ||||
| REF 7 | MiR-625-3p promotes cell migration and invasion via inhibition of SCAI in colorectal carcinoma cells.Oncotarget. 2015 Sep 29;6(29):27805-15. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.