Content Navigation
( All
None )
Target General Information |
Top |
Target ID |
T00140 |
Target Info
|
Target Name |
Arachidonate 5-lipoxygenase (5-LOX) |
Synonyms |
LOG5; 5-lipoxygenase; 5-LO |
Target Type |
Successful Target |
Gene Name |
ALOX5 |
Biochemical Class |
Oxygenase |
UniProt ID |
|
The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-19a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ugugcaaaucuaugcaaaacuga
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[1] |
Representative Target(s) Regulated by This miRNA |
Adrenergic receptor beta-1 (ADRB1)
|
Target Info
|
|
Apoptosis signal-regulating kinase 1 (MAP3K5)
|
Target Info
|
|
References |
Top |
REF 1 |
5-lipoxygenase is a direct target of miR-19a-3p and miR-125b-5p. J Immunol. 2015 Feb 15;194(4):1646-53.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.