Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T00973 Target Info
Target Name Polybromo-1 (PBRM1)
Synonyms hPB1; Protein polybromo-1; Polybromo-1D; PB1; BRG1-associated factor 180; BAF180
Target Type Literature-reported Target
Gene Name PBRM1
UniProt ID
Q86U86
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Proteomics [1]
2 Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-485-3p miRNA Info
miRNA Mature AC
MIMAT0002176
Sequence gucauacacggcucuccucucu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot; Immunosorbent [3]
Representative Target(s) Regulated by This miRNA NT-3 growth factor receptor (TrkC) Target Info
NTRK3_HUMAN
Polybromo-1 (PBRM1) Target Info
PB1_HUMAN
References  Top
REF 1 Widespread changes in protein synthesis induced by microRNAs.Nature. 2008 Sep 4;455(7209):58-63.
REF 2 Transcriptome and targetome analysis in MIR155 expressing cells using RNA-seq. RNA. 2010 Aug;16(8):1610-22.
REF 3 The microRNA miR-485 targets host and influenza virus transcripts to regulate antiviral immunity and restrict viral replication. Sci Signal. 2015 Dec 8;8(406):ra126.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.