Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T03279 |
Target Info
|
| Target Name |
Ribosomal protein S6 kinase alpha-3 (RSK3) |
| Synonyms |
pp90RSK2; p90RSK3; p90-RSK 3; S6K-alpha-3; Ribosomal S6 kinase 2; RSK2; RSK-2; MAPKAPK1B; MAPKAPK-1b; MAPKAP kinase 1b; MAPK-activated protein kinase 1b; MAP kinase-activated protein kinase 1b; Insulin-stimulated protein kinase 1; ISPK1; ISPK-1; 90 kDa ribosomal protein S6 kinase 3 |
| Target Type |
Patented-recorded Target |
| Gene Name |
RPS6KA3 |
| Biochemical Class |
Kinase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-191-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
caacggaaucccaaaagcagcug
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-191 extensively mediates RPS6KA3 target expression through coding sequence (CDS) pairing. |
[2] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Immunohistochemistry; Western Blot |
[1] |
| 2 |
Luciferase Reporter Assay; Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
CCAAT/enhancer binding protein beta (CEBPB)
|
Target Info
|
|
|
Cyclin-dependent kinase 6 (CDK6)
|
Target Info
|
|
| References |
Top |
| REF 1 |
miR-191 suppresses angiogenesis by activation of NF-B signaling. FASEB J. 2017 Aug;31(8):3321-3333.
|
| REF 2 |
MiR-191 Regulates Primary Human Fibroblast Proliferation and Directly Targets Multiple Oncogenes. PLoS One. 2015 May 20;10(5):e0126535.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
