Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T03556 Target Info
Target Name Hepatocyte nuclear factor 1-alpha (HNF1A)
Synonyms Transcription factor-1; Transcription factor 1; TCF1; TCF-1; Liver-specific transcription factor LF-B1; Liver specific transcription factor LF-B1; LFB1; HNF-1A; HNF-1-alpha; HNF-1 alpha
Target Type Clinical trial Target
Gene Name HNF1A
UniProt ID
P20823
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-15b-5p miRNA Info
miRNA Mature AC
MIMAT0000417
Sequence uagcagcacaucaugguuuaca
miRNA Species Homo sapiens
Regulation Mechanism Addition of miR-15b mimics resulted in a significant decrease in activity for the reporter carrying the wild type HNF1A 3'UTR, but did not affect the reporter activity with the mutant HNF1A3'UT indicing that HNF1A is a direct target of miR-15b and that the 7 nt base-pairing sites in its 3'UTR were where miR-15b binds HNF1A transcripts. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Checkpoint kinase-1 (CHK1) Target Info
CHK1_HUMAN
References  Top
REF 1 Modulation of HBV replication by microRNA-15b through targeting hepatocyte nuclear factor 1. Nucleic Acids Res. 2014 Jun;42(10):6578-90.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.