| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-181c-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
aacauucaaccugucggugagu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-181c directly targeted and inhibited the ST8SIA4 expression, as well as miR-181c was inversely correlated with the levels of ST8SIA4 expression. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Immunohistochemistry; Luciferase Reporter Assay; Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
|
Bone morphogenetic protein receptor (BMPR2)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-26b-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uucaaguaauucaggauaggu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-26b interacts specifically with and regulate the 3'UTR of ST8SIA4. |
[2] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
ATP-binding cassette transporter A1 (ABCA1)
|
Target Info
|
|
|
Collagen I (COL1A2)
|
Target Info
|
|
