Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T05849 Target Info
Target Name Gastrin/cholecystokinin type B receptor (CCKBR)
Synonyms Cholecystokinin-2 receptor; CCKRB; CCK2-R; CCK-BR; CCK-B receptor
Target Type Successful Target
Gene Name CCKBR
Biochemical Class GPCR rhodopsin
UniProt ID
P32239
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-148a-3p miRNA Info
miRNA Mature AC
MIMAT0000243
Sequence ucagugcacuacagaacuuugu
miRNA Species Homo sapiens
Regulation Mechanism Expression of miR-148a inversely correlated with cholecystokinin B receptor protein in gastric cancer. [4]
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay; Microarray [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 qRT-PCR; Western Blot [4]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-148b-3p miRNA Info
miRNA Mature AC
MIMAT0000759
Sequence ucagugcaucacagaacuuugu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-148b-3p by mature miRNA mimics tranfection resulted in the decreased protein level of target CCKBR. [4]
Evidence Score (E-score) 3 +
1 In Situ Hybridization; Luciferase Reporter Assay; qRT-PCR; Western Blot [5]
2 In Situ Hybridization; Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
3 Luciferase Reporter Assay [6]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-152-3p miRNA Info
miRNA Mature AC
MIMAT0000438
Sequence ucagugcaugacagaacuugg
miRNA Species Homo sapiens
Regulation Mechanism Expression of miR-152 inversely correlated with cholecystokinin B receptor protein in gastric cancer. [4]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [4]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
References  Top
REF 1 Human microRNAs miR-22, miR-138-2, miR-148a, and miR-488 are associated with panic disorder and regulate several anxiety candidate genes and related pathways. Biol Psychiatry. 2011 Mar 15;69(6):526-33.
REF 2 MiR-148a Functions as a Tumor Suppressor by Targeting CCK-BR via Inactivating STAT3 and Akt in Human Gastric Cancer. PLoS One. 2016 Aug 12;11(8):e0158961.
REF 3 MiR-148a regulates the growth and apoptosis in pancreatic cancer by targeting CCKBR and Bcl-2. Tumour Biol. 2014 Jan;35(1):837-44.
REF 4 Altered expression of MiR-148a and MiR-152 in gastrointestinal cancers and its clinical significance. J Gastrointest Surg. 2010 Jul;14(7):1170-9.
REF 5 MicroRNA-148b suppresses cell growth by targeting cholecystokinin-2 receptor in colorectal cancer. Int J Cancer. 2012 Sep 1;131(5):1042-51.
REF 6 MicroRNA-148b is frequently down-regulated in gastric cancer and acts as a tumor suppressor by inhibiting cell proliferation. Mol Cancer. 2011 Jan 4;10:1.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.