Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T07063 Target Info
Target Name Sodium/iodide cotransporter (SLC5A5)
Synonyms Solute carrier family 5 member 5; Sodium/iodide symporter; Sodium-iodide symporter; Na+/I-symporter; Na(+)/I(-) symporter; Na(+)/I(-) cotransporter; NIS
Target Type Clinical trial Target
Gene Name SLC5A5
Biochemical Class Solute:sodium symporter
UniProt ID
Q92911
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-146b-5p miRNA Info
miRNA Mature AC
MIMAT0002809
Sequence ugagaacugaauuccauaggcug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Calgranulin D (S100A12) Target Info
S10AC_HUMAN
DNA-binding factor KBF1 (p105) Target Info
NFKB1_HUMAN
References  Top
REF 1 Inhibition of miR-146b expression increases radioiodine-sensitivity in poorly differential thyroid carcinoma via positively regulating NIS expression. Biochem Biophys Res Commun. 2015 Jul 10;462(4):314-21.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.