Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T07806 Target Info
Target Name 5-HT 1B receptor (HTR1B)
Synonyms Serotonin receptor 1B; Serotonin 1D beta receptor; S12; HTR1DB; 5-hydroxytryptamine receptor 1B; 5-HT1B receptor; 5-HT1B; 5-HT-1D-beta; 5-HT-1B
Target Type Successful Target
Gene Name HTR1B
Biochemical Class GPCR rhodopsin
UniProt ID
P28222
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-96-5p miRNA Info
miRNA Mature AC
MIMAT0000095
Sequence uuuggcacuagcacauuuuugcu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Literature Reported [1]
2 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA 5-HT 1B receptor (HTR1B) Target Info
5HT1B_HUMAN
ALK tyrosine kinase receptor (ALK) Target Info
ALK_HUMAN
References  Top
REF 1 Evaluation of single nucleotide polymorphisms in the miR-183-96-182 cluster in adulthood attention-deficit and hyperactivity disorder (ADHD) and su... Eur Neuropsychopharmacol. 2013 Nov;23(11):1463-73.
REF 2 A common polymorphism in serotonin receptor 1B mRNA moderates regulation by miR-96 and associates with aggressive human behaviors. Mol Psychiatry. 2009 Apr;14(4):381-9.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.