miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-96-5p | ||||
| miRNA Stemloop AC | MI0000098 | ||||
| miRNA Stemloop ID | hsa-mir-96 | ||||
| Sequence | uuuggcacuagcacauuuuugcu | ||||
| TTD Target(s) Regulated by This miRNA | ALK tyrosine kinase receptor (ALK) | Successful Target | Target Info | [1] | |
| 5-HT 1B receptor (HTR1B) | Successful Target | Target Info | [2] | ||
| Glycogen synthase kinase-3 beta (GSK-3B) | Clinical trial Target | Target Info | [3] | ||
| Brain-derived neurotrophic factor (BDNF) | Clinical trial Target | Target Info | [4] | ||
| Glial cell line-derived neurotrophic factor (GDNF) | Clinical trial Target | Target Info | [5] | ||
| Protein arginine methyltransferase 5 (PRMT5) | Clinical trial Target | Target Info | [6] | ||
| Isoleucyl-tRNA synthetase (IARS) | Literature-reported Target | Target Info | [7] | ||
| DNA repair protein RAD51 homolog 1 (RAD51) | Clinical trial Target | Target Info | [8] | ||
| Forkhead box protein O1A (FOXO1) | Literature-reported Target | Target Info | [9] | ||
| Excitatory amino acid transporter 3 (SLC1A1) | Literature-reported Target | Target Info | [10] | ||
| Insulin receptor substrate-1 (IRS1) | Clinical trial Target | Target Info | [11] | ||
| Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [12] | ||
| Scavenger receptor class B member 1 (SCARB1) | Literature-reported Target | Target Info | [13] | ||
| Suppressor of tumorigenicity 15 protein (ST15) | Literature-reported Target | Target Info | [14] | ||
| Protein(s) Regulated by This miRNA | Adenylate cyclase type 6 | Regulated Protein | [15] | ||
| DNA repair protein REV1 | Regulated Protein | [8] | |||
| Forkhead box protein O3 | Regulated Protein | [17] | |||
| Forkhead box protein O3 | Regulated Protein | [18] | |||
| Metalloproteinase inhibitor 1 | Regulated Protein | [19] | |||
| Metastasis suppressor protein 1 | Regulated Protein | [20] | |||
| Microphthalmia-associated transcription factor | Regulated Protein | [15] | |||
| Sodium- and chloride-dependent taurine transporter | Regulated Protein | [10] | |||
| Tribbles homolog 3 | Regulated Protein | [22] | |||
| Tumor protein p53-inducible nuclear protein 1 | Regulated Protein | [17] | |||
| Tyrosine-protein phosphatase non-receptor type 9 | Regulated Protein | [23] | |||
| Zinc finger E-box-binding homeobox 1 | Regulated Protein | [24] | |||
| Zinc finger protein SNAI2 | Regulated Protein | [24] | |||
| References | |||||
| REF 1 | MicroRNA 96 is a post-transcriptional suppressor of anaplastic lymphoma kinase expression. Am J Pathol. 2012 May;180(5):1772-80. | ||||
| REF 2 | A common polymorphism in serotonin receptor 1B mRNA moderates regulation by miR-96 and associates with aggressive human behaviors. Mol Psychiatry. 2009 Apr;14(4):381-9. | ||||
| REF 3 | Glycogen synthase kinase 3 beta inhibits microRNA-183-96-182 cluster via the -Catenin/TCF/LEF-1 pathway in gastric cancer cells. Nucleic Acids Res. 2014 Mar;42(5):2988-98. | ||||
| REF 4 | Brain-derived neurotrophic factor is a novel target gene of the has-miR-183/96/182 cluster in retinal pigment epithelial cells following visible light exposure. Mol Med Rep. 2015 Aug;12(2):2793-9. | ||||
| REF 5 | GDNF Overexpression from the Native Locus Reveals its Role in the Nigrostriatal Dopaminergic System Function. PLoS Genet. 2015 Dec 17;11(12):e1005710. | ||||
| REF 6 | Protein arginine methyltransferase 5 suppresses the transcription of the RB family of tumor suppressors in leukemia and lymphoma cells. Mol Cell Biol. 2008 Oct;28(20):6262-77. | ||||
| REF 7 | The induction of miR-96 by mitochondrial dysfunction causes impaired glycogen synthesis through translational repression of IRS-1 in SK-Hep1 cells. Biochem Biophys Res Commun. 2013 May 10;434(3):503-8. | ||||
| REF 8 | MiR-96 downregulates REV1 and RAD51 to promote cellular sensitivity to cisplatin and PARP inhibition. Cancer Res. 2012 Aug 15;72(16):4037-46. | ||||
| REF 9 | Coordinate regulation of FOXO1 by miR-27a, miR-96, and miR-182 in breast cancer cells. J Biol Chem. 2009 Aug 28;284(35):23204-16. | ||||
| REF 10 | Widespread microRNA dysregulation in multiple system atrophy - disease-related alteration in miR-96. Eur J Neurosci. 2014 Mar;39(6):1026-41. | ||||
| REF 11 | Micro RNA 145 targets the insulin receptor substrate-1 and inhibits the growth of colon cancer cells. J Biol Chem. 2007 Nov 9;282(45):32582-90. | ||||
| REF 12 | Upregulation of microRNA-96 and its oncogenic functions by targeting CDKN1A in bladder cancer. Cancer Cell Int. 2015 Nov 14;15:107. | ||||
| REF 13 | MicroRNAs 185, 96, and 223 repress selective high-density lipoprotein cholesterol uptake through posttranscriptional inhibition. Mol Cell Biol. 2013 May;33(10):1956-64. | ||||
| REF 14 | A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64. | ||||
| REF 15 | MicroRNA (miRNA) transcriptome of mouse retina and identification of a sensory organ-specific miRNA cluster.J Biol Chem. 2007 Aug 24;282(34):25053-66. | ||||
| REF 16 | MiR-96 downregulates REV1 and RAD51 to promote cellular sensitivity to cisplatin and PARP inhibition. Cancer Res. 2012 Aug 15;72(16):4037-46. | ||||
| REF 17 | MicroRNA-96 promotes the proliferation of colorectal cancer cells and targets tumor protein p53 inducible nuclear protein 1, forkhead box protein O1 (FOXO1) and FOXO3a. Mol Med Rep. 2015 Feb;11(2):1200-6. | ||||
| REF 18 | Unregulated miR-96 induces cell proliferation in human breast cancer by downregulating transcriptional factor FOXO3a.PLoS One. 2010 Dec 23;5(12):e15797. | ||||
| REF 19 | ANT2 shRNA downregulates miR-19a and miR-96 through the PI3K/Akt pathway and suppresses tumor growth in hepatocellular carcinoma cells.Exp Mol Med. 2016 Mar 25;48:e222. | ||||
| REF 20 | Calcium channel blockers in myocardial infarction.Arch Intern Med. 1989 Jul;149(7):1669-77. Review | ||||
| REF 21 | Widespread microRNA dysregulation in multiple system atrophy - disease-related alteration in miR-96. Eur J Neurosci. 2014 Mar;39(6):1026-41. | ||||
| REF 22 | Down-regulation of miR-96 by bone morphogenetic protein signaling is critical for vascular smooth muscle cell phenotype modulation.J Cell Biochem. 2014 May;115(5):889-95. | ||||
| REF 23 | miR-96 promotes cell proliferation, migration and invasion by targeting PTPN9 in breast cancer.Sci Rep. 2016 Nov 18;6:37421. | ||||
| REF 24 | A p21-ZEB1 complex inhibits epithelial-mesenchymal transition through the microRNA 183-96-182 cluster.Mol Cell Biol. 2014 Feb;34(3):533-50. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.