Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T09544 |
Target Info
|
| Target Name |
Galectin-1 (LGALS1) |
| Synonyms |
SLac lectin 1; S-Lac lectin 1; Putative MAPKactivating protein PM12; Putative MAPK-activating protein PM12; Lectin galactosidebinding soluble 1; Lectin galactoside-binding soluble 1; Lactosebinding lectin 1; Lactose-binding lectin 1; HPL; HLBP14; HBL; Galaptin; Gal1; Gal-1; Betagalactosidebinding lectin L14I; Beta-galactoside-binding lectin L-14-I; 14 kDa lectin; 14 kDa lamininbinding protein; 14 kDa laminin-binding protein |
| Target Type |
Patented-recorded Target |
| Gene Name |
LGALS1 |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-22-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
aagcugccaguugaagaacugu
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Dual Luciferase Reporter Assay; Western Blot; RT-PCR |
[1] |
| 2 |
Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
5-HT 2C receptor (HTR2C)
|
Target Info
|
|
|
ATP-citrate synthase (ACLY)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MiRNA-22 inhibits oncogene galectin-1 in hepatocellular carcinoma. Oncotarget. 2016 Aug 30;7(35):57099-57116.
|
| REF 2 |
Galectin-1 has potential prognostic significance and is implicated in clear cell renal cell carcinoma progression through the HIF/mTOR signaling axis. Br J Cancer. 2014 Mar 4;110(5):1250-9.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
