miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-22-3p | ||||
miRNA Stemloop AC | MI0000078 | ||||
miRNA Stemloop ID | hsa-mir-22 | ||||
Sequence | aagcugccaguugaagaacugu | ||||
TTD Target(s) Regulated by This miRNA | Erbb2 tyrosine kinase receptor (HER2) | Successful Target | Target Info | [1] | |
Estrogen receptor (ESR) | Successful Target | Target Info | [2] | ||
Monoamine oxidase type A (MAO-A) | Successful Target | Target Info | [3] | ||
Peroxisome proliferator-activated receptor alpha (PPARA) | Successful Target | Target Info | [4] | ||
5-HT 2C receptor (HTR2C) | Successful Target | Target Info | [3] | ||
BDNF/NT-3 growth factors receptor (TrkB) | Successful Target | Target Info | [5] | ||
C-X-C chemokine receptor type 2 (CXCR2) | Successful Target | Target Info | [6] | ||
Histone deacetylase 6 (HDAC6) | Clinical trial Target | Target Info | [7] | ||
RAC-alpha serine/threonine-protein kinase (AKT1) | Clinical trial Target | Target Info | [6] | ||
Histone deacetylase 4 (HDAC4) | Clinical trial Target | Target Info | [8] | ||
Matrix metalloproteinase-14 (MMP-14) | Clinical trial Target | Target Info | [9] | ||
NAD-dependent deacetylase sirtuin-1 (SIRT1) | Clinical trial Target | Target Info | [10] | ||
Polo-like kinase 1 (PLK1) | Clinical trial Target | Target Info | [11] | ||
Erbb3 tyrosine kinase receptor (Erbb-3) | Clinical trial Target | Target Info | [12] | ||
Basigin (BSG) | Clinical trial Target | Target Info | [13] | ||
Brain-derived neurotrophic factor (BDNF) | Clinical trial Target | Target Info | [3] | ||
Hypoxia-inducible factor 1 alpha (HIF-1A) | Clinical trial Target | Target Info | [14] | ||
Transcription factor Sp1 (SP1) | Clinical trial Target | Target Info | [15] | ||
Colony stimulating factor-1 receptor (CSF-1R) | Clinical trial Target | Target Info | [16] | ||
ATP-citrate synthase (ACLY) | Successful Target | Target Info | [17] | ||
Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [18] | ||
Cyclin A2 (CCNA2) | Literature-reported Target | Target Info | [19] | ||
HepG2 glucose transporter (SLC2A1) | Preclinical Target | Target Info | [20] | ||
High mobility group protein B1 (HMGB1) | Literature-reported Target | Target Info | [21] | ||
Metastasis associated gene-1 (MTA1) | Literature-reported Target | Target Info | [22] | ||
Transferrin receptor protein 1 (TFRC) | Clinical trial Target | Target Info | [23] | ||
Cysteine-rich angiogenic inducer 61 (CYR61) | Literature-reported Target | Target Info | [24] | ||
G0/G1 switch regulatory protein 8 (RGS2) | Literature-reported Target | Target Info | [3] | ||
Galectin-1 (LGALS1) | Patented-recorded Target | Target Info | [14] | ||
Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [25] | ||
Metastasis adhesion protein (MTDH) | Literature-reported Target | Target Info | [26] | ||
T-lymphoma invasion and metastasis 1 (TIAM1) | Literature-reported Target | Target Info | [27] | ||
B-cell translocation gene 1 protein (BTG1) | Literature-reported Target | Target Info | [28] | ||
Protein(s) Regulated by This miRNA | Actin-related protein 2/3 complex subunit 5 | Regulated Protein | [29] | ||
Activin receptor type-1C | Regulated Protein | [30] | |||
Bone morphogenetic protein 6 | Regulated Protein | [31] | |||
Bone morphogenetic protein 7 | Regulated Protein | [32] | |||
Bone morphogenetic protein receptor type-1B | Regulated Protein | [31] | |||
CD151 antigen | Regulated Protein | [33] | |||
E3 ubiquitin-protein ligase UBR5 | Regulated Protein | [34] | |||
Galectin-9 | Regulated Protein | [35] | |||
Interferon regulatory factor 5 | Regulated Protein | [21] | |||
MDS1 and EVI1 complex locus protein | Regulated Protein | [37] | |||
Methylcytosine dioxygenase TET2 | Regulated Protein | [38] | |||
Neuroepithelial cell-transforming gene 1 protein | Regulated Protein | [39] | |||
Nuclear receptor coactivator 1 | Regulated Protein | [40] | |||
Parathymosin | Regulated Protein | [41] | |||
Protein phosphatase 1K, mitochondrial | Regulated Protein | [42] | |||
Proto-oncogene Wnt-1 | Regulated Protein | [43] | |||
Ras-related protein Rab-5B | Regulated Protein | [44] | |||
REST corepressor 1 | Regulated Protein | [45] | |||
Transcription elongation factor A protein-like 1 | Regulated Protein | [46] | |||
Transcription factor 7 | Regulated Protein | [47] | |||
Transforming acidic coiled-coil-containing protein 1 | Regulated Protein | [44] | |||
Zinc finger protein SNAI1 | Regulated Protein | [9] | |||
References | |||||
REF 1 | Dual Action of miR-125b As a Tumor Suppressor and OncomiR-22 Promotes Prostate Cancer Tumorigenesis. PLoS One. 2015 Nov 6;10(11):e0142373. | ||||
REF 2 | The micro-ribonucleic acid (miRNA) miR-206 targets the human estrogen receptor-alpha (ERalpha) and represses ERalpha messenger RNA and protein expression in breast cancer cell lines. Mol Endocrinol. 2007 May;21(5):1132-47. | ||||
REF 3 | Human microRNAs miR-22, miR-138-2, miR-148a, and miR-488 are associated with panic disorder and regulate several anxiety candidate genes and related pathways. Biol Psychiatry. 2011 Mar 15;69(6):526-33. | ||||
REF 4 | Michael T. McManus: Interrupting biology [interview by Hema Bashyam]. J Exp Med. 2008 Mar 17;205(3):506-7. | ||||
REF 5 | NTRK2 is an oncogene and associated with microRNA-22 regulation in human gastric cancer cell lines. Tumour Biol. 2016 Nov;37(11):15115-15123. | ||||
REF 6 | The lncRNA MALAT1 protects the endothelium against ox-LDL-induced dysfunction via upregulating the expression of the miR-22-3p target genes CXCR2 and AKT. FEBS Lett. 2015 Oct 7;589(20 Pt B):3189-96. | ||||
REF 7 | MicroRNA-22 Promoted Osteogenic Differentiation of Human Periodontal Ligament Stem Cells by Targeting HDAC6. J Cell Biochem. 2017 Jul;118(7):1653-1658. | ||||
REF 8 | microRNA-22, downregulated in hepatocellular carcinoma and correlated with prognosis, suppresses cell proliferation and tumourigenicity. Br J Cancer. 2010 Oct 12;103(8):1215-20. | ||||
REF 9 | MicroRNA-22 inhibits tumor growth and metastasis in gastric cancer by directly targeting MMP14 and Snail. Cell Death Dis. 2015 Nov 26;6:e2000. | ||||
REF 10 | miR-22 inhibits the proliferation, motility, and invasion of human glioblastoma cells by directly targeting SIRT1. Tumour Biol. 2016 May;37(5):6761-8. | ||||
REF 11 | Identification of post-transcriptional regulatory networks during myeloblast-to-monocyte differentiation transition. RNA Biol. 2015;12(7):690-700. | ||||
REF 12 | Tumor suppressor miR-22 suppresses lung cancer cell progression through post-transcriptional regulation of ErbB3. J Cancer Res Clin Oncol. 2012 Aug;138(8):1355-61. | ||||
REF 13 | A regulatory loop involving miR-22, Sp1, and c-Myc modulates CD147 expression in breast cancer invasion and metastasis. Cancer Res. 2014 Jul 15;74(14):3764-78. | ||||
REF 14 | Galectin-1 has potential prognostic significance and is implicated in clear cell renal cell carcinoma progression through the HIF/mTOR signaling axis. Br J Cancer. 2014 Mar 4;110(5):1250-9. | ||||
REF 15 | miR-22 represses cancer progression by inducing cellular senescence. J Cell Biol. 2011 Apr 18;193(2):409-24. | ||||
REF 16 | MicroRNA-Mediated Down-Regulation of M-CSF Receptor Contributes to Maturation of Mouse Monocyte-Derived Dendritic Cells. Front Immunol. 2013 Oct 30;4:353. | ||||
REF 17 | miR-22 inhibits tumor growth and metastasis by targeting ATP citrate lyase: evidence in osteosarcoma, prostate cancer, cervical cancer and lung cancer. Oncotarget. 2016 Jul 12;7(28):44252-44265. | ||||
REF 18 | Identification of the miR-106b~25 microRNA cluster as a proto-oncogenic PTEN-targeting intron that cooperates with its host gene MCM7 in transformation. Sci Signal. 2010 Apr 13;3(117):ra29. | ||||
REF 19 | MiR-22-silenced cyclin A expression in colon and liver cancer cells is regulated by bile acid receptor. J Biol Chem. 2015 Mar 6;290(10):6507-15. | ||||
REF 20 | miR-22 as a prognostic factor targets glucose transporter protein type 1 in breast cancer. Cancer Lett. 2015 Jan 28;356(2 Pt B):410-7. | ||||
REF 21 | A Myc-microRNA network promotes exit from quiescence by suppressing the interferon response and cell-cycle arrest genes. Nucleic Acids Res. 2013 Feb 1;41(4):2239-54. | ||||
REF 22 | MTA1-activated Epi-microRNA-22 regulates E-cadherin and prostate cancer invasiveness. FEBS Lett. 2017 Mar;591(6):924-933. | ||||
REF 23 | miR-320 targets transferrin receptor 1 (CD71) and inhibits cell proliferation. Exp Hematol. 2009 Feb;37(2):245-55. | ||||
REF 24 | A novel p53/microRNA-22/Cyr61 axis in synovial cells regulates inflammation in rheumatoid arthritis. Arthritis Rheumatol. 2014 Jan;66(1):49-59. | ||||
REF 25 | A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64. | ||||
REF 26 | microRNA-22 acts as a metastasis suppressor by targeting metadherin in gastric cancer. Mol Med Rep. 2015 Jan;11(1):454-60. | ||||
REF 27 | miRNA-22 suppresses colon cancer cell migration and invasion by inhibiting the expression of T-cell lymphoma invasion and metastasis 1 and matrix metalloproteinases 2 and 9. Oncol Rep. 2013 May;29(5):1932-8. | ||||
REF 28 | MiR-22 regulates 5-FU sensitivity by inhibiting autophagy and promoting apoptosis in colorectal cancer cells. Cancer Lett. 2015 Jan 28;356(2 Pt B):781-90. | ||||
REF 29 | Interaction between microRNAs and actin-associated protein Arpc5 regulates translational suppression during male germ cell differentiation.Proc Natl Acad Sci U S A. 2012 Apr 10;109(15):5750-5. | ||||
REF 30 | MicroRNA 376c enhances ovarian cancer cell survival by targeting activin receptor-like kinase 7: implications for chemoresistance.J Cell Sci. 2011 Feb 1;124(Pt 3):359-68. | ||||
REF 31 | MicroRNA-22 is a master regulator of bone morphogenetic protein-7/6 homeostasis in the kidney.J Biol Chem. 2013 Dec 20;288(51):36202-14. | ||||
REF 32 | Integrative microRNA and proteomic approaches identify novel osteoarthritis genes and their collaborative metabolic and inflammatory networks. PLoS One. 2008;3(11):e3740. | ||||
REF 33 | MiR-22 suppresses the proliferation and invasion of gastric cancer cells by inhibiting CD151.Biochem Biophys Res Commun. 2014 Feb 28;445(1):175-9. | ||||
REF 34 | EDD1 predicts prognosis and regulates gastric cancer growth in vitro and in vivo via miR-22. Biol Chem. 2016 Apr 28. pii: /j/bchm.just-accepted/hsz-2015-0279/hsz-2015-0279.xml. | ||||
REF 35 | microRNA-22 downregulation of galectin-9 influences lymphocyte apoptosis and tumor cell proliferation in liver cancer.Oncol Rep. 2015 Oct;34(4):1771-8. | ||||
REF 36 | A Myc-microRNA network promotes exit from quiescence by suppressing the interferon response and cell-cycle arrest genes. Nucleic Acids Res. 2013 Feb 1;41(4):2239-54. | ||||
REF 37 | The PU.1-Modulated MicroRNA-22 Is a Regulator of Monocyte/Macrophage Differentiation and Acute Myeloid Leukemia.PLoS Genet. 2016 Sep 12;12(9):e1006259. | ||||
REF 38 | MicroRNA-antagonism regulates breast cancer stemness and metastasis via TET-family-dependent chromatin remodeling.Cell. 2013 Jul 18;154(2):311-324. | ||||
REF 39 | miR-22 regulates expression of oncogenic neuro-epithelial transforming gene 1, NET1.FEBS J. 2014 Sep;281(17):3904-19. | ||||
REF 40 | MicroRNA-22 and microRNA-140 suppress NF-B activity by regulating the expression of NF-B coactivators.Biochem Biophys Res Commun. 2011 Aug 12;411(4):826-31. | ||||
REF 41 | MicroRNA-22 can reduce parathymosin expression in transdifferentiated hepatocytes.PLoS One. 2012;7(4):e34116. | ||||
REF 42 | Regulation of PP2Cm expression by miRNA-204/211 and miRNA-22 in mouse and human cells.Acta Pharmacol Sin. 2015 Dec;36(12):1480-6. | ||||
REF 43 | Diallyl disulfide suppresses proliferation and induces apoptosis in human gastric cancer through Wnt-1 signaling pathway by up-regulation of miR-200b and miR-22.Cancer Lett. 2013 Oct 28;340(1):72-81. | ||||
REF 44 | Deep Sequencing Reveals a Novel miR-22 Regulatory Network with Therapeutic Potential in Rhabdomyosarcoma.Cancer Res. 2016 Oct 15;76(20):6095-6106. | ||||
REF 45 | MicroRNA-22 (miR-22) overexpression is neuroprotective via general anti-apoptotic effects and may also target specific Huntington's disease-related mechanisms. PLoS One. 2013;8(1):e54222. | ||||
REF 46 | Tumor suppressor miR-22 determines p53-dependent cellular fate through post-transcriptional regulation of p21.Cancer Res. 2011 Jul 1;71(13):4628-39. | ||||
REF 47 | Elevated Hepatic miR-22-3p Expression Impairs Gluconeogenesis by Silencing the Wnt-Responsive Transcription Factor Tcf7.Diabetes. 2015 Nov;64(11):3659-69. | ||||
REF 48 | MicroRNA-22 inhibits tumor growth and metastasis in gastric cancer by directly targeting MMP14 and Snail. Cell Death Dis. 2015 Nov 26;6:e2000. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.