Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T10265 |
Target Info
|
| Target Name |
Phosphodiesterase 4B (PDE4B) |
| Synonyms |
cAMP-specific 3',5'-cyclic phosphodiesterase 4B; Type 4B cAMP phosphodiesterase; Type 4 cyclic adenosine monophosphate phosphodiesterase (type 4 PDE); PDE32; DPDE4 |
| Target Type |
Clinical trial Target |
| Gene Name |
PDE4B |
| Biochemical Class |
Phosphoric diester hydrolase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-34a-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
caaucagcaaguauacugcccu
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
|
Beta-catenin (CTNNB1)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-330-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ucucugggccugugucuuaggc
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| Representative Target(s) Regulated by This miRNA |
Integrin alpha-5 (ITGA5)
|
Target Info
|
|
|
Mucin-1 (MUC1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
The microRNA network is altered in anterior cingulate cortex of patients with unipolar and bipolar depression. J Psychiatr Res. 2016 Nov;82:58-67.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
