Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T10822 Target Info
Target Name Cyclin-dependent kinase 8 (CDK8)
Synonyms Protein kinase K35; Mediator of RNA polymerase II transcription subunit CDK8; Mediator complex subunit CDK8; Cell division protein kinase 8
Target Type Clinical trial Target
Gene Name CDK8
Biochemical Class Kinase
UniProt ID
P49336
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-107 miRNA Info
miRNA Mature AC
MIMAT0000104
Sequence agcagcauuguacagggcuauca
miRNA Species Homo sapiens
Regulation Mechanism miR-107 could regulate proliferation of gastric cancer by targeting CDK8. [2]
Evidence Score (E-score) 2 +
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
Caveolin 1 (CAV1) Target Info
CAV1_HUMAN
miRNA Mature ID hsa-miR-195-5p miRNA Info
miRNA Mature AC
MIMAT0000461
Sequence uagcagcacagaaauauuggc
miRNA Species Homo sapiens
Regulation Mechanism miR-195-5p binds the 3'untranslated region (UTR) of CDK8, suggesting that CDK8 should be a direct target of miR-195-5p. [3]
Evidence Score (E-score) 1 +
Representative Target(s) Regulated by This miRNA ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
References  Top
REF 1 MiRNA-107 inhibits proliferation and migration by targeting CDK8 in breast cancer. Int J Clin Exp Med. 2014 Jan 15;7(1):32-40. eCollection 2014.
REF 2 MicroRNA-107 promotes proliferation of gastric cancer cells by targeting cyclin dependent kinase 8. Diagn Pathol. 2014 Aug 28;9:164.
REF 3 Tumor-suppressive microRNA-195-5p regulates cell growth and inhibits cell cycle by targeting cyclin dependent kinase 8 in colon cancer. Am J Transl Res. 2016 May 15;8(5):2088-96.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.