Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T11615 Target Info
Target Name Cystine/glutamate transporter (SLC7A11)
Synonyms XCT; X(c)-cystine transporter; X(c)- plasma membrane cystine transporter; Solute carrier family 7 member 11; Calcium channel blocker resistance protein CCBR1; Amino acid transport system xc-; Amino acid transport system XCT
Target Type Clinical trial Target
Gene Name SLC7A11
Biochemical Class Amino acid-polyamine-organocation
UniProt ID
Q9UPY5
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-122-5p miRNA Info
miRNA Mature AC
MIMAT0000421
Sequence uggagugugacaaugguguuug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; qRT-PCR [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
miRNA Mature ID hsa-miR-27a-3p miRNA Info
miRNA Mature AC
MIMAT0000084
Sequence uucacaguggcuaaguuccgc
miRNA Species Homo sapiens
Regulation Mechanism miRNA-27a negatively regulates SLC7A11 in cisplatin-resistant bladder cancer. [2]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
References  Top
REF 1 MicroRNA-122, a tumor suppressor microRNA that regulates intrahepatic metastasis of hepatocellular carcinoma. Hepatology. 2009 May;49(5):1571-82.
REF 2 Reduced expression of miRNA-27a modulates cisplatin resistance in bladder cancer by targeting the cystine/glutamate exchanger SLC7A11. Clin Cancer Res. 2014 Apr 1;20(7):1990-2000.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.