miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-27a-3p
miRNA Stemloop AC MI0000085
miRNA Stemloop ID hsa-mir-27a
Sequence uucacaguggcuaaguuccgc
TTD Target(s) Regulated by This miRNA Epidermal growth factor receptor (EGFR) Successful Target Target Info [1]
HMG-CoA reductase (HMGCR) Successful Target Target Info [2]
Peroxisome proliferator-activated receptor gamma (PPAR-gamma) Successful Target Target Info [3]
PI3-kinase gamma (PIK3CG) Successful Target Target Info [4]
Proto-oncogene c-Met (MET) Successful Target Target Info [5]
ATP-binding cassette transporter A1 (ABCA1) Successful Target Target Info [6]
Interferon-gamma (IFNG) Successful Target Target Info [7]
Low-density lipoprotein receptor (LDL-R) Successful Target Target Info [8]
Retinoic acid receptor RXR-alpha (RXRA) Successful Target Target Info [9]
Thyroid hormone receptor beta (THRB) Successful Target Target Info [10]
Dihydrothymine dehydrogenase (DPYD) Successful Target Target Info [11]
Glycogen synthase kinase-3 beta (GSK-3B) Clinical trial Target Target Info [12]
Matrix metalloproteinase-13 (MMP-13) Clinical trial Target Target Info [13]
Retinoic acid receptor alpha (RARA) Clinical trial Target Target Info [9]
Stress-activated protein kinase 2a (p38 alpha) Clinical trial Target Target Info [14]
Wee1-like protein kinase (WEE1) Clinical trial Target Target Info [15]
Cellular tumor antigen p53 (TP53) Clinical trial Target Target Info [16]
Enhancer of zeste homolog 2 (EZH2) Successful Target Target Info [17]
G1/S-specific cyclin-D1 (CCND1) Clinical trial Target Target Info [18]
Nuclear factor erythroid 2-related factor 2 (Nrf2) Successful Target Target Info [19]
Hypoxia-inducible factor 1 alpha (HIF-1A) Clinical trial Target Target Info [20]
Tissue factor pathway inhibitor (TFPI) Clinical trial Target Target Info [21]
Insulin-like growth factor-I (IGF1) Clinical trial Target Target Info [22]
Transcription factor Sp1 (SP1) Clinical trial Target Target Info [23]
Forkhead box protein O1A (FOXO1) Literature-reported Target Target Info [24]
GATA-binding factor 3 (GATA3) Literature-reported Target Target Info [25]
Homeodomain interacting protein kinase 2 (HIPK2) Literature-reported Target Target Info [26]
Mannose receptor (MRC1) Literature-reported Target Target Info [27]
Cystine/glutamate transporter (SLC7A11) Clinical trial Target Target Info [28]
Dickkopf-related protein 2 (DKK2) Literature-reported Target Target Info [29]
F-box and WD-40 domain protein 7 (Fbxw7) Literature-reported Target Target Info [30]
Prohibitin (PHB) Literature-reported Target Target Info [31]
Yes-associated protein 1 (YAP1) Literature-reported Target Target Info [32]
Protein(s) Regulated by This miRNA 14-3-3 protein zeta/delta Regulated Protein
1433Z_HUMAN
[33]
5'-AMP-activated protein kinase catalytic subunit alpha-2 Regulated Protein
AAPK2_HUMAN
[34]
Adenomatous polyposis coli protein Regulated Protein
APC_HUMAN
[35]
BCL2/adenovirus E1B 19 kDa protein-interacting protein 3 Regulated Protein
BNIP3_HUMAN
[36]
Calcium-binding protein 39-like Regulated Protein
CB39L_HUMAN
[36]
Calponin-3 Regulated Protein
CNN3_HUMAN
[36]
Cell division cycle protein 27 homolog Regulated Protein
CDC27_HUMAN
[37]
Cyclin-Y-like protein 1 Regulated Protein
CCYL1_HUMAN
[36]
Cysteine-rich secretory protein 2 Regulated Protein
CRIS2_HUMAN
[36]
Dual specificity mitogen-activated protein kinase kinase 4 Regulated Protein
MP2K4_HUMAN
[38]
E3 ubiquitin-protein transferase RMND5A Regulated Protein
RMD5A_HUMAN
[36]
Endothelial transcription factor GATA-2 Regulated Protein
GATA2_HUMAN
[39]
Follistatin-related protein 1 Regulated Protein
FSTL1_HUMAN
[40]
Homeobox protein Hox-A10 Regulated Protein
HXA10_HUMAN
[41]
Interferon alpha/beta receptor 1 Regulated Protein
INAR1_HUMAN
[42]
Lysosome-associated membrane glycoprotein 2 Regulated Protein
LAMP2_HUMAN
[43]
Methylosome protein 50 Regulated Protein
MEP50_HUMAN
[44]
Mothers against decapentaplegic homolog 2 Regulated Protein
SMAD2_HUMAN
[45]
Mothers against decapentaplegic homolog 4 Regulated Protein
SMAD4_HUMAN
[46]
Mothers against decapentaplegic homolog 5 Regulated Protein
SMAD5_HUMAN
[47]
Myelin transcription factor 1 Regulated Protein
MYT1_HUMAN
[23]
Paired box protein Pax-3 Regulated Protein
PAX3_HUMAN
[49]
PH domain leucine-rich repeat-containing protein phosphatase 2 Regulated Protein
PHLP2_HUMAN
[50]
Phosphatidate phosphatase LPIN1 Regulated Protein
LPIN1_HUMAN
[36]
Poly(U)-specific endoribonuclease Regulated Protein
ENDOU_HUMAN
[36]
Prosaposin Regulated Protein
SAP_HUMAN
[51]
Protein BTG2 Regulated Protein
BTG2_HUMAN
[52]
Protein BTG2 Regulated Protein
BTG2_HUMAN
[53]
Protein sprouty homolog 2 Regulated Protein
SPY2_HUMAN
[54]
Secreted frizzled-related protein 1 Regulated Protein
SFRP1_HUMAN
[55]
Secreted frizzled-related protein 1 Regulated Protein
SFRP1_HUMAN
[56]
Semaphorin-6A Regulated Protein
SEM6A_HUMAN
[57]
Semaphorin-7A Regulated Protein
SEM7A_HUMAN
[7]
Serine/threonine-protein kinase PINK1, mitochondrial Regulated Protein
PINK1_HUMAN
[59]
Serine/threonine-protein kinase WNK1 Regulated Protein
WNK1_HUMAN
[36]
Serine/threonine-protein phosphatase CPPED1 Regulated Protein
CPPED_HUMAN
[36]
Sialoadhesin Regulated Protein
SN_HUMAN
[60]
Sister chromatid cohesion protein PDS5 homolog B Regulated Protein
PDS5B_HUMAN
[61]
Sodium- and chloride-dependent creatine transporter 1 Regulated Protein
SC6A8_HUMAN
[62]
TBC1 domain family member 9 Regulated Protein
TBCD9_HUMAN
[63]
Transcription factor Sp3 Regulated Protein
SP3_HUMAN
[23]
Transcription factor Sp4 Regulated Protein
SP4_HUMAN
[23]
Zinc finger and BTB domain-containing protein 10 Regulated Protein
ZBT10_HUMAN
[23]
Zinc finger protein PLAG1 Regulated Protein
PLAG1_HUMAN
[64]
Zinc finger protein RFP Regulated Protein
TRI27_HUMAN
[60]
References
REF 1 Mutant p53-R273H gains new function in sustained activation of EGFR signaling via suppressing miR-27a expression. Cell Death Dis. 2013 Apr 4;4:e574.
REF 2 Transcriptomic Analysis of Chronic Hepatitis B and C and Liver Cancer Reveals MicroRNA-Mediated Control of Cholesterol Synthesis Programs. MBio. 2015 Dec 8;6(6):e01500-15.
REF 3 Hypoxia mediates mutual repression between microRNA-27a and PPAR in the pulmonary vasculature. PLoS One. 2013 Nov 14;8(11):e79503.
REF 4 MiR-27a regulates apoptosis in nucleus pulposus cells by targeting PI3K. PLoS One. 2013 Sep 25;8(9):e75251.
REF 5 Cross-talk between MET and EGFR in non-small cell lung cancer involves miR-27a and Sprouty2. Proc Natl Acad Sci U S A. 2013 May 21;110(21):8573-8.
REF 6 MicroRNA-27a/b regulates cellular cholesterol efflux, influx and esterification/hydrolysis in THP-1 macrophages. Atherosclerosis. 2014 May;234(1):54-64.
REF 7 Alternative capture of noncoding RNAs or protein-coding genes by herpesviruses to alter host T cell function. Mol Cell. 2014 Apr 10;54(1):67-79.
REF 8 Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
REF 9 MicroRNA-27a Contributes to Rhabdomyosarcoma Cell Proliferation by Suppressing RARA and RXRA. PLoS One. 2015 Apr 27;10(4):e0125171.
REF 10 MicroRNA-27a regulates beta cardiac myosin heavy chain gene expression by targeting thyroid hormone receptor beta1 in neonatal rat ventricular myocytes. Mol Cell Biol. 2011 Feb;31(4):744-55.
REF 11 microRNAs miR-27a and miR-27b directly regulate liver dihydropyrimidine dehydrogenase expression through two conserved binding sites. Mol Cancer Ther. 2014 Mar;13(3):742-51.
REF 12 Transcriptional suppression of microRNA-27a contributes to laryngeal cancer differentiation via GSK-3-involved Wnt/-catenin pathway. Oncotarget. 2017 Feb 28;8(9):14708-14718.
REF 13 Regulation of the IGFBP-5 and MMP-13 genes by the microRNAs miR-140 and miR-27a in human osteoarthritic chondrocytes. BMC Musculoskelet Disord. 2009 Nov 30;10:148.
REF 14 Regulation of Insulin Resistance by Multiple MiRNAs via Targeting the GLUT4 Signalling Pathway. Cell Physiol Biochem. 2016;38(5):2063-78.
REF 15 Prediction of Associations between microRNAs and Gene Expression in Glioma Biology. PLoS One. 2011 Feb 16;6(2):e14681.
REF 16 Negative regulation of tumor suppressor p53 by microRNA miR-504. Mol Cell. 2010 Jun 11;38(5):689-99.
REF 17 Analysis of EZH2: micro-RNA network in low and high grade astrocytic tumors. Brain Tumor Pathol. 2016 Apr;33(2):117-28.
REF 18 Down-regulation of miR-27a might inhibit proliferation and drug resistance of gastric cancer cells. J Exp Clin Cancer Res. 2011 May 13;30:55.
REF 19 Identification of novel microRNAs in post-transcriptional control of Nrf2 expression and redox homeostasis in neuronal, SH-SY5Y cells. PLoS One. 2012;7(12):e51111.
REF 20 HIF-1 Induces Multidrug Resistance in Gastric Cancer Cells by Inducing MiR-27a. PLoS One. 2015 Aug 20;10(8):e0132746.
REF 21 The role of microRNA-27a/b and microRNA-494 in estrogen-mediated downregulation of tissue factor pathway inhibitor . J Thromb Haemost. 2016 Jun;14(6):1226-37.
REF 22 A novel oncogenic mechanism in Ewing sarcoma involving IGF pathway targeting by EWS/Fli1-regulated microRNAs. Oncogene. 2011 Dec 8;30(49):4910-20.
REF 23 The oncogenic microRNA-27a targets genes that regulate specificity protein transcription factors and the G2-M checkpoint in MDA-MB-231 breast cancer cells. Cancer Res. 2007 Nov 15;67(22):11001-11.
REF 24 Coordinate regulation of FOXO1 by miR-27a, miR-96, and miR-182 in breast cancer cells. J Biol Chem. 2009 Aug 28;284(35):23204-16.
REF 25 miR-23 7 4 clusters control effector T cell differentiation and function. J Exp Med. 2016 Feb 8;213(2):235-49.
REF 26 MiR-27a modulates MDR1/P-glycoprotein expression by targeting HIPK2 in human ovarian cancer cells. Gynecol Oncol. 2010 Oct;119(1):125-30.
REF 27 MicroRNA Cargo of Extracellular Vesicles from Alcohol-exposed Monocytes Signals Naive Monocytes to Differentiate into M2 Macrophages. J Biol Chem. 2016 Jan 1;291(1):149-59.
REF 28 Reduced expression of miRNA-27a modulates cisplatin resistance in bladder cancer by targeting the cystine/glutamate exchanger SLC7A11. Clin Cancer Res. 2014 Apr 1;20(7):1990-2000.
REF 29 The transcription factor ccaat/enhancer binding protein (C/EBP) and miR-27a regulate the expression of porcine Dickkopf2 (DKK2). Sci Rep. 2015 Dec 11;5:17972.
REF 30 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 31 MicroRNA-27a functions as an oncogene in gastric adenocarcinoma by targeting prohibitin. Cancer Lett. 2009 Jan 18;273(2):233-42.
REF 32 MicroRNA-27a-3p regulates epithelial to mesenchymal transition via targeting YAP1 in oral squamous cell carcinoma cells. Oncol Rep. 2016 Sep;36(3):1475-82.
REF 33 MiR-27a functions as a tumor suppressor in acute leukemia by regulating 14-3-3.PLoS One. 2012;7(12):e50895.
REF 34 miR-27a-mediated antiproliferative effects of metformin on the breast cancer cell line MCF-7.Oncol Rep. 2016 Dec;36(6):3691-3699.
REF 35 miR-27 promotes human gastric cancer cell metastasis by inducing epithelial-to-mesenchymal transition.Cancer Genet. 2011 Sep;204(9):486-91.
REF 36 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 37 MiR-27a modulates radiosensitivity of triple-negative breast cancer (TNBC) cells by targeting CDC27.Med Sci Monit. 2015 May 6;21:1297-303.
REF 38 MicroRNA-27a promotes proliferation, migration and invasion by targeting MAP2K4 in human osteosarcoma cells.Cell Physiol Biochem. 2014;33(2):402-12.
REF 39 SON protein regulates GATA-2 through transcriptional control of the microRNA 23a~27a~24-2 cluster.J Biol Chem. 2013 Feb 22;288(8):5381-8.
REF 40 MicroRNA-27a Inhibits Cell Migration and Invasion of Fibroblast-Like Synoviocytes by Targeting Follistatin-Like Protein 1 in Rheumatoid Arthritis.Mol Cells. 2016 Aug 31;39(8):611-8.
REF 41 Genetic variations in miR-27a gene decrease mature miR-27a level and reduce gastric cancer susceptibility.Oncogene. 2014 Jan 9;33(2):193-202.
REF 42 The TGF--inducible miR-23a cluster attenuates IFN- levels and antigen-specific cytotoxicity in human CD8 T cells. J Leukoc Biol. 2014 Oct;96(4):633-45.
REF 43 MicroRNA-27a Promotes Inefficient Lysosomal Clearance in the Hippocampi of Rats Following Chronic Brain Hypoperfusion.Mol Neurobiol. 2017 May;54(4):2595-2610.
REF 44 MicroRNA-27a regulates basal transcription by targeting the p44 subunit of general transcription factor IIH.Proc Natl Acad Sci U S A. 2011 May 24;108(21):8686-91.
REF 45 MIR-27a regulates the TGF- signaling pathway by targeting SMAD2 and SMAD4 in lung cancer.Mol Carcinog. 2017 Aug;56(8):1992-1998.
REF 46 MicroRNA-27a-3p Is a Negative Regulator of Lung Fibrosis by Targeting Myofibroblast Differentiation.Am J Respir Cell Mol Biol. 2016 Jun;54(6):843-52.
REF 47 miR-23a and miR-27a promote human granulosa cell apoptosis by targeting SMAD5.Biol Reprod. 2015 Oct;93(4):98.
REF 48 The oncogenic microRNA-27a targets genes that regulate specificity protein transcription factors and the G2-M checkpoint in MDA-MB-231 breast cancer cells. Cancer Res. 2007 Nov 15;67(22):11001-11.
REF 49 Muscle stem cell behavior is modified by microRNA-27 regulation of Pax3 expression.Proc Natl Acad Sci U S A. 2009 Aug 11;106(32):13383-7.
REF 50 MicroRNA-27a contributes to the malignant behavior of gastric cancer cells by directly targeting PH domain and leucine-rich repeat protein phosphatase 2.J Exp Clin Cancer Res. 2017 Mar 21;36(1):45.
REF 51 The microRNA-23b/27b/24 cluster promotes breast cancer lung metastasis by targeting metastasis-suppressive gene prosaposin.J Biol Chem. 2014 Aug 8;289(32):21888-95.
REF 52 miR 7a suppresses the clonogenic growth and migration of human glioblastoma multiforme cells by targeting BTG2.Int J Oncol. 2015 Apr;46(4):1601-8.
REF 53 MiR-27a-3p functions as an oncogene in gastric cancer by targeting BTG2.Oncotarget. 2016 Aug 9;7(32):51943-51954.
REF 54 miR-27a regulates the growth, colony formation and migration of pancreatic cancer cells by targeting Sprouty2.Cancer Lett. 2010 Dec 8;298(2):150-8.
REF 55 In vivo and in vitro effects of microRNA-27a on proliferation, migration and invasion of breast cancer cells through targeting of SFRP1 gene via Wnt/-catenin signaling pathway.Oncotarget. 2017 Feb 28;8(9):15507-15519.
REF 56 MiRNA-27a promotes the proliferation and invasion of human gastric cancer MGC803 cells by targeting SFRP1 via Wnt/-catenin signaling pathway. Am J Cancer Res. 2017 Mar 1;7(3):405-416.
REF 57 MicroRNA-27a/b controls endothelial cell repulsion and angiogenesis by targeting semaphorin 6A.Blood. 2012 Feb 9;119(6):1607-16.
REF 58 Alternative capture of noncoding RNAs or protein-coding genes by herpesviruses to alter host T cell function. Mol Cell. 2014 Apr 10;54(1):67-79.
REF 59 miR-27a and miR-27b regulate autophagic clearance of damaged mitochondria by targeting PTEN-induced putative kinase 1 (PINK1).Mol Neurodegener. 2016 Jul 26;11(1):55.
REF 60 Type I IFN-Inducible Downregulation of MicroRNA-27a Feedback Inhibits Antiviral Innate Response by Upregulating Siglec1/TRIM27.J Immunol. 2016 Feb 1;196(3):1317-26.
REF 61 Identification of novel AR-targeted microRNAs mediating androgen signalling through critical pathways to regulate cell viability in prostate cancer. PLoS One. 2013;8(2):e56592.
REF 62 Proteomic screening identifies calreticulin as a miR-27a direct target repressing MHC class I cell surface exposure in colorectal cancer.Cell Death Dis. 2016 Feb 25;7:e2120.
REF 63 Role of miR-27a, miR-181a and miR-20b in gastric cancer hypoxia-induced chemoresistance. Cancer Biol Ther. 2016 Apr 2;17(4):400-6.
REF 64 MiR-424 and miR-27a increase TRAIL sensitivity of acute myeloid leukemia by targeting PLAG1.Oncotarget. 2016 May 3;7(18):25276-90.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.