The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-374a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uuauaauacaaccugauaagug
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Overexpression of miR-374a by p-miR-374a in HCC827 cells significantly decreased the protein expression of WNT5A. |
[1] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; Immunofluorescence |
[1] |
2 |
Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
ATM serine/threonine kinase (ATM)
|
Target Info
|
|
CCAAT/enhancer binding protein beta (CEBPB)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-487b-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aaucguacagggucauccacuu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-487b directly targeted WNT5A. |
[3] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[3] |
Representative Target(s) Regulated by This miRNA |
Metabotropic glutamate receptor 3 (mGluR3)
|
Target Info
|
|
Polycomb complex protein BMI-1 (BMI1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-154-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uagguuauccguguugccuucg
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-154 functions as a tumor suppressor in glioblastoma by targeting WNT5A. |
[4] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[4] |
Representative Target(s) Regulated by This miRNA |
High mobility group protein HMGI-C (HMGA2)
|
Target Info
|
|
Toll-like receptor 2 (TLR2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-154-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aaucauacacgguugaccuauu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-54 functions as a tumor suppressor in OS by partially suppressing WNT5A expression. |
[5] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[5] |
Representative Target(s) Regulated by This miRNA |
Wnt-5a protein (WNT5A)
|
Target Info
|
|