Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T16016 |
Target Info
|
| Target Name |
C-C chemokine receptor type 1 (CCR1) |
| Synonyms |
SCYAR1; RANTES-R; Macrophage inflammatory protein-1 alpha receptor; Macrophage inflammatory protein 1-alpha receptor; MIP-1alpha-R; LD78 receptor; HM145; Chemokine receptor CCR1; CMKR1; CMKBR1; CD191; CCR-1; CC-CKR-1; C-C CKR-1 |
| Target Type |
Clinical trial Target |
| Gene Name |
CCR1 |
| Biochemical Class |
GPCR rhodopsin |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-21-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uagcuuaucagacugauguuga
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis antigen ligand (CD178)
|
Target Info
|
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-181d-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ccaccgggggaugaaugucac
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-181d attenuated IGF-1-upregulated CCR1 and IL-1b gene expressions demonstrating a distinct role for IGF-1 signaling in glioma progression via miR-181d/cytokine networks. |
[2] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
qRT-PCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
C-C chemokine receptor type 1 (CCR1)
|
Target Info
|
|
|
Interleukin 1 receptor type 1 (IL1R1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Induction of miR-21 by retinoic acid in estrogen receptor-positive breast carcinoma cells: biological correlates and molecular targets. J Biol Chem. 2011 Feb 4;286(5):4027-42.
|
| REF 2 |
Identification of IGF-1-enhanced cytokine expressions targeted by miR-181d in glioblastomas via an integrative miRNA/mRNA regulatory network analysis. Sci Rep. 2017 Apr 7;7(1):732.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
