Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T16117 |
Target Info
|
| Target Name |
Nitric-oxide synthase brain (NOS1) |
| Synonyms |
Peptidyl-cysteine S-nitrosylase NOS1; Nitric oxide synthase, brain; Neuronal NOS; NOS, type I; NOS type I; NNOS; NC-NOS; N-NOS; BNOS |
| Target Type |
Clinical trial Target |
| Gene Name |
NOS1 |
| Biochemical Class |
Paired donor oxygen oxidoreductase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-146a-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ugagaacugaauuccauggguu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
The binding site of miR-146a was found to be located within the 3'UTR of the NOS1. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| 2 |
Luciferase Reporter Assay |
[2] |
| Representative Target(s) Regulated by This miRNA |
Activation B7-1 antigen (CD80)
|
Target Info
|
|
|
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
| References |
Top |
| REF 1 |
A Variant in the Precursor of MicroRNA-146a is Responsible for Development of Erectile Dysfunction in Patients with Chronic Prostatitis via Targeting NOS1. Med Sci Monit. 2017 Feb 20;23:929-937.
|
| REF 2 |
Rs2910164 in microRNA 146a confers an elevated risk of depression in patients with coronary artery disease by modulating the expression of NOS1. Mol Med Rep. 2018 Jul;18(1):603-609.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
