Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T22118 |
Target Info
|
| Target Name |
Dopamine D1 receptor (D1R) |
| Synonyms |
D(1A) dopamine receptor |
| Target Type |
Successful Target |
| Gene Name |
DRD1 |
| Biochemical Class |
GPCR rhodopsin |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-382-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
gaaguuguucgugguggauucg
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-382-5p binds to DRD1 and inhibits DRD1 expressioin. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| 2 |
Western Blot; qRT-PCR |
[1] |
| Representative Target(s) Regulated by This miRNA |
Dopamine D1 receptor (D1R)
|
Target Info
|
|
|
Phosphatase and tensin homolog (PTEN)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-504-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
agacccuggucugcacucuauc
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
|
Bcl-2-binding component 3 (BBC3)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNA expression profile and functional analysis reveal that miR-382 is a critical novel gene of alcohol addiction. EMBO Mol Med. 2013 Sep;5(9):1402-14.
|
| REF 2 |
Differential allelic expression of dopamine D1 receptor gene (DRD1) is modulated by microRNA miR-504. Biol Psychiatry. 2009 Apr 15;65(8):702-5.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
