The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-377-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aucacacaaaggcaacuuuugu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
In a luciferase assay in which the 3 -UTRs of SOD1 were included in the pGL3R vector, miR-377 considerably reduced luciferase activity. |
[2] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; |
[1] |
2 |
Luciferase Reporter Assay; Western Blot |
[2] |
Representative Target(s) Regulated by This miRNA |
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
DNA [cytosine-5]-methyltransferase 1 (DNMT1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-206 |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uggaauguaaggaagugugugg
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
SOD1 was a direct target for miR-206. |
[3] |
Evidence Score (E-score) |
1 |
+ |
1 |
Immunohistochemistry; Luciferase Reporter Assay; Western Blot |
[3] |
Representative Target(s) Regulated by This miRNA |
Annexin A2 (ANXA2)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|