| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-1236-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ccucuuccccuugucucuccag
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-1236 mimic repressed the activity of 3'UTR of RORC, and the level of RORC was also downregulated by miR-1236 mimic. In addition, the miR-1236 inhibitor lowered the binding with 3'UTR of RORC, and the level of RORC was correspondingly increased. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Western Blot |
[1] |
| Representative Target(s) Regulated by This miRNA |
Nuclear receptor ROR-gamma (RORG)
|
Target Info
|
|
|
Vascular endothelial growth factor receptor 2 (KDR)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-30b-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
cugggagguggauguuuacuuc
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-30b interacts with Rorc mRNA. |
[2] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay |
[2] |
| Representative Target(s) Regulated by This miRNA |
Beclin-1 (BECN1)
|
Target Info
|
|
|
Nuclear receptor ROR-gamma (RORG)
|
Target Info
|
|
