Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T30082 |
Target Info
|
| Target Name |
Acetylcholinesterase (AChE) |
| Synonyms |
YT; N-ACHE; ARACHE |
| Target Type |
Successful Target |
| Gene Name |
ACHE |
| Biochemical Class |
Carboxylic ester hydrolase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-212-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uaacagucuccagucacggcc
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
In Situ Hybridization; Luciferase Reporter Assay; Western Blot |
[1] |
| 2 |
Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Acetylcholinesterase (AChE)
|
Target Info
|
|
|
Adenylate cyclase type 1 (ADCY1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Synaptic acetylcholinesterase targeted by microRNA-212 functions as a tumor suppressor in non-small cell lung cancer. Int J Biochem Cell Biol. 2013 Nov;45(11):2530-40.
|
| REF 2 |
Detrusor induction of miR-132/212 following bladder outlet obstruction: association with MeCP2 repression and cell viability. PLoS One. 2015 Jan 24;10(1):e0116784.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
