miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-212-3p | ||||
| miRNA Stemloop AC | MI0000288 | ||||
| miRNA Stemloop ID | hsa-mir-212 | ||||
| Sequence | uaacagucuccagucacggcc | ||||
| TTD Target(s) Regulated by This miRNA | Acetylcholinesterase (AChE) | Successful Target | Target Info | [1] | |
| ATP-binding cassette transporter G2 (ABCG2) | Successful Target | Target Info | [2] | ||
| Adenylate cyclase type 1 (ADCY1) | Successful Target | Target Info | [2] | ||
| Renal carcinoma antigen NY-REN-64 (IRAK-4) | Clinical trial Target | Target Info | [3] | ||
| Superoxide dismutase Mn (SOD Mn) | Clinical trial Target | Target Info | [4] | ||
| G2/mitotic-specific cyclin B1 (CCNB1) | Patented-recorded Target | Target Info | [5] | ||
| Proto-oncogene c-Myc (MYC) | Literature-reported Target | Target Info | [6] | ||
| Cyclin A2 (CCNA2) | Literature-reported Target | Target Info | [5] | ||
| Inward rectifier potassium channel Kir2.1 (KCNJ2) | Literature-reported Target | Target Info | [7] | ||
| Methyl cpg binding protein 2 (MECP2) | Clinical trial Target | Target Info | [8] | ||
| Protein(s) Regulated by This miRNA | Astrocytic phosphoprotein PEA-15 | Regulated Protein | [9] | ||
| Histone deacetylase complex subunit SAP30 | Regulated Protein | [10] | |||
| Mothers against decapentaplegic homolog 2 | Regulated Protein | [11] | |||
| Paxillin | Regulated Protein | [12] | |||
| Protein patched homolog 1 | Regulated Protein | [13] | |||
| Regulatory factor X-associated protein | Regulated Protein | [14] | |||
| Retinoblastoma-associated protein | Regulated Protein | [5] | |||
| Retinol-binding protein 2 | Regulated Protein | [16] | |||
| Serine/threonine-protein kinase Sgk3 | Regulated Protein | [17] | |||
| Tight junction protein ZO-1 | Regulated Protein | [18] | |||
| Transcription factor SOX-11 | Regulated Protein | [2] | |||
| Transcription factor SOX-4 | Regulated Protein | [20] | |||
| References | |||||
| REF 1 | Synaptic acetylcholinesterase targeted by microRNA-212 functions as a tumor suppressor in non-small cell lung cancer. Int J Biochem Cell Biol. 2013 Nov;45(11):2530-40. | ||||
| REF 2 | SOX11 identified by target gene evaluation of miRNAs differentially expressed in focal and non-focal brain tissue of therapy-resistant epilepsy patients. Neurobiol Dis. 2015 May;77:127-40. | ||||
| REF 3 | Regulation of TLR2-mediated tolerance and cross-tolerance through IRAK4 modulation by miR-132 and miR-212. J Immunol. 2013 Feb 1;190(3):1250-63. | ||||
| REF 4 | Genetic and epigenetic down-regulation of microRNA-212 promotes colorectal tumor metastasis via dysregulation of MnSOD. Gastroenterology. 2013 Aug;145(2):426-36.e1-6. | ||||
| REF 5 | miR-132 and miR-212 are increased in pancreatic cancer and target the retinoblastoma tumor suppressor. Biochem Biophys Res Commun. 2011 Mar 25;406(4):518-23. | ||||
| REF 6 | Down-regulation of miR-212 expression by DNA hypermethylation in human gastric cancer cells. Med Oncol. 2011 Dec;28 Suppl 1:S189-96. | ||||
| REF 7 | A novel dual-fluorescence strategy for functionally validating microRNA targets in 3' untranslated regions: regulation of the inward rectifier potassium channel K(ir)2.1 by miR-212. Biochem J. 2012 Nov 15;448(1):103-13. | ||||
| REF 8 | miR-212 is downregulated and suppresses methyl-CpG-binding protein MeCP2 in human gastric cancer. Int J Cancer. 2010 Sep 1;127(5):1106-14. | ||||
| REF 9 | miR-212 increases tumor necrosis factor-related apoptosis-inducing ligand sensitivity in non-small cell lung cancer by targeting the antiapoptotic protein PED.Cancer Res. 2010 May 1;70(9):3638-46. | ||||
| REF 10 | Comparative study of joint bioinformatics analysis of underlying potential of 'neurimmiR', miR-212-3P/miR-132-3P, being involved in epilepsy and its emerging role in human cancer.Oncotarget. 2017 Jun 20;8(25):40668-40682. | ||||
| REF 11 | miR-212/132 downregulates SMAD2 expression to suppress the G1/S phase transition of the cell cycle and the epithelial to mesenchymal transition in cervical cancer cells.IUBMB Life. 2015 May;67(5):380-94. | ||||
| REF 12 | MicroRNA-212 functions as an epigenetic-silenced tumor suppressor involving in tumor metastasis and invasion of gastric cancer through down-regulat... Am J Cancer Res. 2015 Sep 15;5(10):2980-97. | ||||
| REF 13 | MicroRNA-212 displays tumor-promoting properties in non-small cell lung cancer cells and targets the hedgehog pathway receptor PTCH1.Mol Biol Cell. 2012 Apr;23(8):1423-34. | ||||
| REF 14 | Pancreatic cancer-derived exosomes transfer miRNAs to dendritic cells and inhibit RFXAP expression via miR-212-3p.Oncotarget. 2015 Oct 6;6(30):29877-88. | ||||
| REF 15 | miR-132 and miR-212 are increased in pancreatic cancer and target the retinoblastoma tumor suppressor. Biochem Biophys Res Commun. 2011 Mar 25;406(4):518-23. | ||||
| REF 16 | Histone demethylase retinoblastoma binding protein 2 is overexpressed in hepatocellular carcinoma and negatively regulated by hsa-miR-212.PLoS One. 2013 Jul 29;8(7):e69784. | ||||
| REF 17 | MiR-212-3p inhibits glioblastoma cell proliferation by targeting SGK3.J Neurooncol. 2015 May;122(3):431-9. | ||||
| REF 18 | Effect of alcohol on miR-212 expression in intestinal epithelial cells and its potential role in alcoholic liver disease. Alcohol Clin Exp Res. 2008 Feb;32(2):355-64. | ||||
| REF 19 | SOX11 identified by target gene evaluation of miRNAs differentially expressed in focal and non-focal brain tissue of therapy-resistant epilepsy patients. Neurobiol Dis. 2015 May;77:127-40. | ||||
| REF 20 | Aryl hydrocarbon receptor-microRNA-212/132 axis in human breast cancer suppresses metastasis by targeting SOX4.Mol Cancer. 2015 Sep 17;14:172. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.