Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T32880 Target Info
Target Name HIF-prolyl hydroxylase 2 (HPH-2)
Synonyms SM-20; Prolyl hydroxylase domain-containing protein 2; PHD2; Hypoxia-inducible factor prolyl hydroxylase 2; HPH-2; HIF-PH2; Egl nine homolog 1; C1orf12
Target Type Patented-recorded Target
Gene Name EGLN1
Biochemical Class Paired donor oxygen oxidoreductase
UniProt ID
Q9GZT9
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
References  Top
REF 1 miR-21 contributes to renal protection by targeting prolyl hydroxylase domain protein 2 in delayed ischaemic preconditioning. Nephrology (Carlton). 2017 May;22(5):366-373.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.