Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T40016 |
Target Info
|
| Target Name |
Glucocorticoid receptor (NR3C1) |
| Synonyms |
Nuclear receptor subfamily 3 group C member 1; GRL; GR |
| Target Type |
Successful Target |
| Gene Name |
NR3C1 |
| Biochemical Class |
Nuclear hormone receptor |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-130b-3p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
cagugcaaugaugaaagggcau
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
qRT-PCR; Western Blot |
[1] |
| 2 |
Sequencing |
[2] |
| Representative Target(s) Regulated by This miRNA |
Acyl-CoA desaturase (SCD)
|
Target Info
|
|
|
Cyclin A2 (CCNA2)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-18a-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uaaggugcaucuagugcagauag
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
Luciferase activity was significantly reduced in the presence of miR-18a, while in the presence of the mutated 3'UTR of NR3C1 luciferase activity was restored, confirming that miR-18a directly targets the 3'UTR of NR3C1. |
[4] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[3] |
| 2 |
Luciferase Reporter Assay; Western Blot |
[4] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Intravenous injection of microvesicle-delivery miR-130b alleviates high-fat diet-induced obesity in C57BL/6 mice through translational repression of PPAR-. J Biomed Sci. 2015 Oct 16;22:86.
|
| REF 2 |
Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
|
| REF 3 |
miR-103 inhibits proliferation and sensitizes hemopoietic tumor cells for glucocorticoid-induced apoptosis. Oncotarget. 2017 Jan 3;8(1):472-489.
|
| REF 4 |
MicroRNA 18 and 124a down-regulate the glucocorticoid receptor: implications for glucocorticoid responsiveness in the brain. Endocrinology. 2009 May;150(5):2220-8.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
