miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-130b-3p | ||||
| miRNA Stemloop AC | MI0000748 | ||||
| miRNA Stemloop ID | hsa-mir-130b | ||||
| Sequence | cagugcaaugaugaaagggcau | ||||
| TTD Target(s) Regulated by This miRNA | Erbb2 tyrosine kinase receptor (HER2) | Successful Target | Target Info | [1] | |
| Matrix metalloproteinase-2 (MMP-2) | Successful Target | Target Info | [2] | ||
| Platelet-derived growth factor receptor alpha (PDGFRA) | Successful Target | Target Info | [3] | ||
| Acyl-CoA desaturase (SCD) | Successful Target | Target Info | [4] | ||
| Glucocorticoid receptor (NR3C1) | Successful Target | Target Info | [5] | ||
| Peroxisome proliferator-activated receptor alpha (PPARA) | Successful Target | Target Info | [4] | ||
| Peroxisome proliferator-activated receptor gamma (PPAR-gamma) | Successful Target | Target Info | [6] | ||
| Signal transducer and activator of transcription 3 (STAT3) | Successful Target | Target Info | [7] | ||
| Low-density lipoprotein receptor (LDL-R) | Successful Target | Target Info | [5] | ||
| S-mephenytoin 4-hydroxylase (CYP2C9) | Successful Target | Target Info | [8] | ||
| Integrin beta-1 (ITGB1) | Clinical trial Target | Target Info | [9] | ||
| Macrophage colony-stimulating factor 1 (CSF1) | Clinical trial Target | Target Info | [10] | ||
| Mitochondrial uncoupling protein 1 (UCP1) | Clinical trial Target | Target Info | [4] | ||
| Insulin-like growth factor-I (IGF1) | Clinical trial Target | Target Info | [11] | ||
| Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [12] | ||
| Cyclin A2 (CCNA2) | Literature-reported Target | Target Info | [5] | ||
| Runt-related transcription factor 3 (RUNX3) | Literature-reported Target | Target Info | [13] | ||
| Interferon regulatory factor 1 (IRF1) | Literature-reported Target | Target Info | [14] | ||
| Protein(s) Regulated by This miRNA | Coiled-coil domain-containing protein 6 | Regulated Protein | [15] | ||
| Delta-like protein 1 | Regulated Protein | [16] | |||
| Hepatocyte growth factor-like protein | Regulated Protein | [17] | |||
| Mothers against decapentaplegic homolog 4 | Regulated Protein | [12] | |||
| Peroxisome proliferator-activated receptor gamma coactivator 1-alpha | Regulated Protein | [19] | |||
| Protein naked cuticle homolog 2 | Regulated Protein | [20] | |||
| Protein salvador homolog 1 | Regulated Protein | [17] | |||
| Synaptic functional regulator FMR1 | Regulated Protein | [21] | |||
| Tumor protein p53-inducible nuclear protein 1 | Regulated Protein | [22] | |||
| Ubiquitin carboxyl-terminal hydrolase CYLD | Regulated Protein | [23] | |||
| UMP-CMP kinase | Regulated Protein | [24] | |||
| UV radiation resistance-associated gene protein | Regulated Protein | [25] | |||
| Zinc finger and BTB domain-containing protein 4 | Regulated Protein | [12] | |||
| Zinc finger E-box-binding homeobox 1 | Regulated Protein | [26] | |||
| Zinc finger protein SNAI3 | Regulated Protein | [27] | |||
| References | |||||
| REF 1 | Up-regulation of Serum MiR-130b-3p Level is Associated with Renal Damage in Early Lupus Nephritis. Sci Rep. 2015 Aug 28;5:12644. | ||||
| REF 2 | MiR-130b suppresses prostate cancer metastasis through down-regulation of MMP2. Mol Carcinog. 2015 Nov;54(11):1292-300. | ||||
| REF 3 | Fibroblast growth factor (FGF) signaling during gastrulation negatively modulates the abundance of microRNAs that regulate proteins required for cell migration and embryo patterning. J Biol Chem. 2012 Nov 9;287(46):38505-14. | ||||
| REF 4 | Intravenous injection of microvesicle-delivery miR-130b alleviates high-fat diet-induced obesity in C57BL/6 mice through translational repression of PPAR-. J Biomed Sci. 2015 Oct 16;22:86. | ||||
| REF 5 | Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41. | ||||
| REF 6 | miR-130 suppresses adipogenesis by inhibiting peroxisome proliferator-activated receptor gamma expression. Mol Cell Biol. 2011 Feb;31(4):626-38. | ||||
| REF 7 | MiR-130b is a prognostic marker and inhibits cell proliferation and invasion in pancreatic cancer through targeting STAT3. PLoS One. 2013 Sep 10;8(9):e73803. | ||||
| REF 8 | Inflammation-associated microRNA-130b down-regulates cytochrome P450 activities and directly targets CYP2C9. Drug Metab Dispos. 2015 Jun;43(6):884-8. | ||||
| REF 9 | MicroRNA- 130b suppresses migration and invasion of colorectal cancer cells through downregulation of integrin 1 [corrected]. PLoS One. 2014 Feb 3;9(2):e87938. | ||||
| REF 10 | Epigenetic silencing of miR-130b in ovarian cancer promotes the development of multidrug resistance by targeting colony-stimulating factor 1. Gynecol Oncol. 2012 Feb;124(2):325-34. | ||||
| REF 11 | miR-130b-3p Modulates Epithelial-Mesenchymal Crosstalk in Lung Fibrosis by Targeting IGF-1. PLoS One. 2016 Mar 8;11(3):e0150418. | ||||
| REF 12 | Identification of a pan-cancer oncogenic microRNA superfamily anchored by a central core seed motif. Nat Commun. 2013;4:2730. | ||||
| REF 13 | MicroRNA-130b regulates the tumour suppressor RUNX3 in gastric cancer. Eur J Cancer. 2010 May;46(8):1456-63. | ||||
| REF 14 | Repression of microRNA-130b by thyroid hormone enhances cell motility. J Hepatol. 2015 Jun;62(6):1328-40. | ||||
| REF 15 | miR-130b-3p Upregulation Contributes to the Development of Thyroid Adenomas Targeting CCDC6 Gene.Eur Thyroid J. 2015 Dec;4(4):213-21. | ||||
| REF 16 | miR-130b-3p inhibits cell invasion and migration by targeting the Notch ligand Delta-like 1 in breast carcinoma.Gene. 2017 Apr 20;609:80-87. | ||||
| REF 17 | Upregulation of miR-130b enhances stem cell-like phenotype in glioblastoma by inactivating the Hippo signaling pathway.Biochem Biophys Res Commun. 2015 Sep 18;465(2):194-9. | ||||
| REF 18 | Identification of a pan-cancer oncogenic microRNA superfamily anchored by a central core seed motif. Nat Commun. 2013;4:2730. | ||||
| REF 19 | Circulating miR-130b mediates metabolic crosstalk between fat and muscle in overweight/obesity.Diabetologia. 2013 Oct;56(10):2275-85. | ||||
| REF 20 | miR-130b targets NKD2 and regulates the Wnt signaling to promote proliferation and inhibit apoptosis in osteosarcoma cells.Biochem Biophys Res Commun. 2016 Mar 18;471(4):479-85. | ||||
| REF 21 | MicroRNA-130b targets Fmr1 and regulates embryonic neural progenitor cell proliferation and differentiation.Biochem Biophys Res Commun. 2013 Oct 4;439(4):493-500. | ||||
| REF 22 | Roles for microRNAs, miR-93 and miR-130b, and tumor protein 53-induced nuclear protein 1 tumor suppressor in cell growth dysregulation by human T-cell lymphotrophic virus 1.Cancer Res. 2008 Nov 1;68(21):8976-85. | ||||
| REF 23 | MiR-130b inhibits proliferation and induces apoptosis of gastric cancer cells via CYLD.Tumour Biol. 2016 Jun;37(6):7981-7. | ||||
| REF 24 | Cytidine monophosphate kinase is inhibited by the TGF- signalling pathway through the upregulation of miR-130b-3p in human epithelial ovarian cancer.Cell Signal. 2017 Jul;35:197-207. | ||||
| REF 25 | p63-microRNA feedback in keratinocyte senescence.Proc Natl Acad Sci U S A. 2012 Jan 24;109(4):1133-8. | ||||
| REF 26 | Mutant p53 gain-of-function induces epithelial-mesenchymal transition through modulation of the miR-130b-ZEB1 axis.Oncogene. 2013 Jul 4;32(27):3286-95. | ||||
| REF 27 | MicroRNA-130b improves renal tubulointerstitial fibrosis via repression of Snail-induced epithelial-mesenchymal transition in diabetic nephropathy.Sci Rep. 2016 Feb 3;6:20475. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.