Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T40488 Target Info
Target Name Matrix metalloproteinase-10 (MMP-10)
Synonyms Transin-2; Stromelysin-2; STMY2; SL-2
Target Type Patented-recorded Target
Gene Name MMP10
Biochemical Class Peptidase
UniProt ID
P09238
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-203a-3p miRNA Info
miRNA Mature AC
MIMAT0000264
Sequence gugaaauguuuaggaccacuag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Immunoblot; In Situ Hybridization; Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
References  Top
REF 1 Regulatory Role of mir-203 in Prostate Cancer Progression and Metastasis. Clin Cancer Res. 2011 Aug 15;17(16):5287-98.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.