miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-203a-3p
miRNA Stemloop AC MI0000283
miRNA Stemloop ID hsa-mir-203
Sequence gugaaauguuuaggaccacuag
miRNA General Information
miRNA Mature ID hsa-miR-203a-3p
miRNA Stemloop AC MI0000283
miRNA Stemloop ID hsa-mir-203a
Sequence gugaaauguuuaggaccacuag
TTD Target(s) Regulated by This miRNA Matrix metalloproteinase-1 (MMP-1) Successful Target Target Info [1]
Proto-oncogene c-Src (SRC) Successful Target Target Info [2]
Tyrosine-protein kinase ABL1 (ABL) Successful Target Target Info [3]
Cyclin-dependent kinase 6 (CDK6) Successful Target Target Info [4]
PI3-kinase alpha (PIK3CA) Successful Target Target Info [5]
Interleukin-6 (IL6) Successful Target Target Info [1]
Interleukin-8 (IL8) Successful Target Target Info [6]
Protein kinase C alpha (PRKCA) Successful Target Target Info [7]
Tumor necrosis factor (TNF) Successful Target Target Info [8]
Endothelin A receptor (EDNRA) Successful Target Target Info [9]
Fibroblast growth factor-2 (FGF2) Successful Target Target Info [10]
Vascular endothelial growth factor A (VEGFA) Successful Target Target Info [11]
Apoptosis inhibitor survivin (BIRC5) Clinical trial Target Target Info [12]
Apoptosis regulator Bcl-W (BCL-W) Clinical trial Target Target Info [13]
ATM serine/threonine kinase (ATM) Clinical trial Target Target Info [14]
Interleukin-24 (IL24) Clinical trial Target Target Info [8]
Leukemia inhibitory factor receptor (LIFR) Clinical trial Target Target Info [15]
E2F transcription factor 1 (E2F1) Clinical trial Target Target Info [16]
Phospholipase D2 (PLD2) Clinical trial Target Target Info [17]
Arachidonate 15-lipoxygenase (15-LOX) Patented-recorded Target Target Info [18]
Signal transducer and activator of transcription 1 (STAT1) Patented-recorded Target Target Info [19]
NF-kappa-B-activating kinase (TBK1) Patented-recorded Target Target Info [20]
Myeloid differentiation primary response protein MyD88 (MYD88) Literature-reported Target Target Info [21]
Transcription factor AP-1 (JUN) Discontinued Target Target Info [22]
RAC-beta serine/threonine-protein kinase (AKT2) Literature-reported Target Target Info [23]
Matrix metalloproteinase-10 (MMP-10) Patented-recorded Target Target Info [16]
Thymidylate synthase (TYMS) Clinical trial Target Target Info [24]
Cyclic AMP-responsive element-binding protein (CREB1) Literature-reported Target Target Info [25]
Polycomb complex protein BMI-1 (BMI1) Clinical trial Target Target Info [26]
Protein phosphatase 1D (PPM1D) Literature-reported Target Target Info [27]
Caveolin 1 (CAV1) Literature-reported Target Target Info [28]
Epithelial cadherin (CDH1) Literature-reported Target Target Info [29]
GAP-associated tyrosine phosphoprotein p62 (KHDRBS1) Literature-reported Target Target Info [30]
Ras-related protein Rab-22A (Rab22a) Literature-reported Target Target Info [31]
Zinc finger E-box-binding homeobox 2 (ZEB2) Literature-reported Target Target Info [16]
Runt-related transcription factor 2 (RUNX2) Literature-reported Target Target Info [32]
Suppressor of cytokine signaling 3 (SOCS3) Literature-reported Target Target Info [33]
Protein(s) Regulated by This miRNA Arf-GAP with SH3 domain, ANK repeat and PH domain-containing protein 1 Regulated Protein
ASAP1_HUMAN
[34]
ATP-binding cassette sub-family E member 1 Regulated Protein
ABCE1_HUMAN
[4]
Barrier-to-autointegration factor Regulated Protein
BAF_HUMAN
[36]
E3 ubiquitin-protein ligase Hakai Regulated Protein
HAKAI_HUMAN
[37]
Eyes absent homolog 4 Regulated Protein
EYA4_HUMAN
[9]
Frizzled-2 Regulated Protein
FZD2_HUMAN
[39]
Ganglioside-induced differentiation-associated protein 1 Regulated Protein
GDAP1_HUMAN
[9]
GTP-binding nuclear protein Ran Regulated Protein
RAN_HUMAN
[40]
Homeobox protein DLX-5 Regulated Protein
DLX5_HUMAN
[16]
Homeobox protein Hox-D3 Regulated Protein
HXD3_HUMAN
[42]
Kinesin-1 heavy chain Regulated Protein
KINH_HUMAN
[43]
Kinesin-like protein KIF2A Regulated Protein
KIF2A_HUMAN
[43]
LIM and SH3 domain protein 1 Regulated Protein
LASP1_HUMAN
[44]
Mothers against decapentaplegic homolog 4 Regulated Protein
SMAD4_HUMAN
[16]
Nuclear receptor subfamily 2 group C member 2 Regulated Protein
NR2C2_HUMAN
[45]
Peripheral plasma membrane protein CASK Regulated Protein
CSKP_HUMAN
[46]
Protein lin-28 homolog B Regulated Protein
LN28B_HUMAN
[47]
Ras-associated and pleckstrin homology domains-containing protein 1 Regulated Protein
RAPH1_HUMAN
[40]
Ras-related protein Rap-1A Regulated Protein
RAP1A_HUMAN
[48]
Suppressor of cytokine signaling 6 Regulated Protein
SOCS6_HUMAN
[8]
Tight junction protein ZO-2 Regulated Protein
ZO2_HUMAN
[50]
Transcription factor 4 Regulated Protein
ITF2_HUMAN
[51]
Tumor protein 63 Regulated Protein
P63_HUMAN
[52]
UV radiation resistance-associated gene protein Regulated Protein
UVRAG_HUMAN
[28]
Wnt inhibitory factor 1 Regulated Protein
WIF1_HUMAN
[54]
Zinc finger protein 148 Regulated Protein
ZN148_HUMAN
[55]
Zinc finger protein SNAI1 Regulated Protein
SNAI1_HUMAN
[56]
Zinc finger protein SNAI2 Regulated Protein
SNAI2_HUMAN
[57]
References
REF 1 Altered expression of microRNA-203 in rheumatoid arthritis synovial fibroblasts and its role in fibroblast activation. Arthritis Rheum. 2011 Feb;63(2):373-81.
REF 2 ING1b-inducible microRNA203 inhibits cell proliferation. Br J Cancer. 2013 Mar 19;108(5):1143-8.
REF 3 Genetic and epigenetic silencing of microRNA-203 enhances ABL1 and BCR-ABL1 oncogene expression. Cancer Cell. 2008 Jun;13(6):496-506.
REF 4 miR-124 and miR-203 are epigenetically silenced tumor-suppressive microRNAs in hepatocellular carcinoma. Carcinogenesis. 2010 May;31(5):766-76.
REF 5 MicroRNA-203 accelerates apoptosis in LPS-stimulated alveolar epithelial cells by targeting PIK3CA. Biochem Biophys Res Commun. 2014 Aug 8;450(4):1297-303.
REF 6 MiRNA-203 Reduces Nasopharyngeal Carcinoma Radioresistance by Targeting IL8/AKT Signaling. Mol Cancer Ther. 2015 Nov;14(11):2653-64.
REF 7 miR-203 inhibits cell proliferation and migration of lung cancer cells by targeting PKC. PLoS One. 2013 Sep 10;8(9):e73985.
REF 8 Regulation of pro-inflammatory cytokines TNF and IL24 by microRNA-203 in primary keratinocytes. Cytokine. 2012 Dec;60(3):741-8.
REF 9 A comprehensive analysis of microRNA expression during human keratinocyte differentiation in vitro and in vivo. J Invest Dermatol. 2011 Jan;131(1):20-9.
REF 10 miR-203 inhibition of renal cancer cell proliferation, migration and invasion by targeting of FGF2. Diagn Pathol. 2015 Apr 9;10:24.
REF 11 miR-203 suppresses tumor growth and angiogenesis by targeting VEGFA in cervical cancer. Cell Physiol Biochem. 2013;32(1):64-73.
REF 12 MicroRNA-203 suppresses cell proliferation and migration by targeting BIRC5 and LASP1 in human triple-negative breast cancer cells. J Exp Clin Cancer Res. 2012 Jun 19;31:58.
REF 13 microRNA-203 suppresses bladder cancer development by repressing bcl-w expression. FEBS J. 2011 Mar;278(5):786-92.
REF 14 Viral microRNA targetome of KSHV-infected primary effusion lymphoma cell lines. Cell Host Microbe. 2011 Nov 17;10(5):515-26.
REF 15 miR-203, a tumor suppressor frequently down-regulated by promoter hypermethylation in rhabdomyosarcoma. J Biol Chem. 2014 Jan 3;289(1):529-39.
REF 16 Regulatory Role of mir-203 in Prostate Cancer Progression and Metastasis. Clin Cancer Res. 2011 Aug 15;17(16):5287-98.
REF 17 MicroRNA-203 inhibits the proliferation and invasion of U251 glioblastoma cells by directly targeting PLD2. Mol Med Rep. 2014 Feb;9(2):503-8.
REF 18 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 19 MiRNA203 suppresses the expression of protumorigenic STAT1 in glioblastoma to inhibit tumorigenesis. Oncotarget. 2016 Dec 20;7(51):84017-84029.
REF 20 MiR-203 Determines Poor Outcome and Suppresses Tumor Growth by Targeting TBK1 in Osteosarcoma. Cell Physiol Biochem. 2015;37(5):1956-66.
REF 21 MyD88 as a target of microRNA-203 in regulation of lipopolysaccharide or Bacille Calmette-Guerin induced inflammatory response of macrophage RAW264.7 cells. Mol Immunol. 2013 Oct;55(3-4):303-9.
REF 22 MicroRNA-203 functions as a tumor suppressor in basal cell carcinoma. Oncogenesis. 2012 Mar 12;1:e3.
REF 23 miR-203 reverses chemoresistance in p53-mutated colon cancer cells through downregulation of Akt2 expression. Cancer Lett. 2011 May 1;304(1):52-9.
REF 24 miR-203 enhances chemosensitivity to 5-fluorouracil by targeting thymidylate synthase in colorectal cancer. Oncol Rep. 2015 Feb;33(2):607-14.
REF 25 Epigenetic silencing of MIR203 in multiple myeloma. Br J Haematol. 2011 Sep;154(5):569-78.
REF 26 Coordinated regulation of polycomb group complexes through microRNAs in cancer. Cancer Cell. 2011 Aug 16;20(2):187-99.
REF 27 Oncogenic Wip1 phosphatase is inhibited by miR-16 in the DNA damage signaling pathway. Cancer Res. 2010 Sep 15;70(18):7176-86.
REF 28 MicroRNA-203 regulates caveolin-1 in breast tissue during caloric restriction. Cell Cycle. 2012 Apr 1;11(7):1291-5.
REF 29 microRNA-203 suppresses invasion of gastric cancer cells by targeting ERK1/2/Slug/ E-cadherin signaling. Cancer Biomark. 2017;19(1):11-20.
REF 30 MicroRNA-203 inhibits the malignant progression of neuroblastoma by targeting Sam68. Mol Med Rep. 2015 Oct;12(4):5554-60.
REF 31 miR-203 Acts as a Tumor Suppressor Gene in Osteosarcoma by Regulating RAB22A. PLoS One. 2015 Sep 18;10(9):e0132225.
REF 32 Targeting of Runx2 by miR-135 and miR-203 Impairs Progression of Breast Cancer and Metastatic Bone Disease. Cancer Res. 2015 Apr 1;75(7):1433-44.
REF 33 MicroRNAs: novel regulators involved in the pathogenesis of psoriasis PLoS One. 2007 Jul 11;2(7):e610.
REF 34 MiR-203 is downregulated in laryngeal squamous cell carcinoma and can suppress proliferation and induce apoptosis of tumours.Tumour Biol. 2014 Jun;35(6):5953-63.
REF 35 miR-124 and miR-203 are epigenetically silenced tumor-suppressive microRNAs in hepatocellular carcinoma. Carcinogenesis. 2010 May;31(5):766-76.
REF 36 BANF1 is downregulated by IRF1-regulated microRNA-203 in cervical cancer.PLoS One. 2015 Feb 6;10(2):e0117035.
REF 37 miR-203 regulates cell proliferation through its influence on Hakai expression.PLoS One. 2012;7(12):e52568.
REF 38 A comprehensive analysis of microRNA expression during human keratinocyte differentiation in vitro and in vivo. J Invest Dermatol. 2011 Jan;131(1):20-9.
REF 39 miR-203 Inhibits Frizzled-2 Expression via CD82/KAI1 Expression in Human Lung Carcinoma Cells.PLoS One. 2015 Jul 1;10(7):e0131350.
REF 40 MicroRNA-203 contributes to skin re-epithelialization.Cell Death Dis. 2012 Nov 29;3:e435.
REF 41 Regulatory Role of mir-203 in Prostate Cancer Progression and Metastasis. Clin Cancer Res. 2011 Aug 15;17(16):5287-98.
REF 42 EGR1 mediates miR-203a suppress the hepatocellular carcinoma cells progression by targeting HOXD3 through EGFR signaling pathway.Oncotarget. 2016 Jul 19;7(29):45302-45316.
REF 43 MicroRNA-203 regulates melanosome transport and tyrosinase expression in melanoma cells by targeting kinesin superfamily protein 5b.J Invest Dermatol. 2014 Feb;134(2):461-469.
REF 44 miR-203 inhibits the migration and invasion of esophageal squamous cell carcinoma by regulating LASP1.Int J Oncol. 2012 Nov;41(5):1653-61.
REF 45 Ectopic expressed miR-203 contributes to chronic obstructive pulmonary disease via targeting TAK1 and PIK3CA. Int J Clin Exp Pathol. 2015 Sep 1;8(9):10662-70.
REF 46 Down-regulation of miR-203 induced by Helicobacter pylori infection promotes the proliferation and invasion of gastric cancer by targeting CASK.Oncotarget. 2014 Nov 30;5(22):11631-40.
REF 47 miR-203 enhances let-7 biogenesis by targeting LIN28B to suppress tumor growth in lung cancer.Sci Rep. 2017 Feb 20;7:42680.
REF 48 miR-203a is involved in HBx-induced inflammation by targeting Rap1a.Exp Cell Res. 2016 Nov 15;349(1):191-197.
REF 49 Regulation of pro-inflammatory cytokines TNF and IL24 by microRNA-203 in primary keratinocytes. Cytokine. 2012 Dec;60(3):741-8.
REF 50 Identification of specific miRNAs targeting proteins of the apical junctional complex that simulate the probiotic effect of E. coli Nissle 1917 on T84 epithelial cells.Int J Biochem Cell Biol. 2012 Feb;44(2):341-9.
REF 51 Comparative effects of diet and carcinogen on microRNA expression in the stem cell niche of the mouse colonic crypt. Biochim Biophys Acta. 2016 Jan;1862(1):121-34.
REF 52 A skin microRNA promotes differentiation by repressing 'stemness'.Nature. 2008 Mar 13;452(7184):225-9.
REF 53 MicroRNA-203 regulates caveolin-1 in breast tissue during caloric restriction. Cell Cycle. 2012 Apr 1;11(7):1291-5.
REF 54 Role of bacterial infection in the epigenetic regulation of Wnt antagonist WIF1 by PRC2 protein EZH2.Oncogene. 2015 Aug 20;34(34):4519-30.
REF 55 Anti-oncogenic microRNA-203 induces senescence by targeting E2F3 protein in human melanoma cells.J Biol Chem. 2012 Apr 6;287(15):11769-77.
REF 56 Signaling between transforming growth factor (TGF-) and transcription factor SNAI2 represses expression of microRNA miR-203 to promote epithelial-mesenchymal transition and tumor metastasis.J Biol Chem. 2013 Apr 12;288(15):10241-53.
REF 57 MiR-182 and miR-203 induce mesenchymal to epithelial transition and self-sufficiency of growth signals via repressing SNAI2 in prostate cells.Int J Cancer. 2013 Aug 1;133(3):544-55.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.