Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T46515 |
Target Info
|
| Target Name |
Isoleucyl-tRNA synthetase (IARS) |
| Synonyms |
Isoleucine--tRNA ligase, cytoplasmic; Isoleucine--tRNA ligase; IleRS; IRS |
| Target Type |
Literature-reported Target |
| Gene Name |
IARS |
| Biochemical Class |
Carbon-oxygen ligase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-96-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uuuggcacuagcacauuuuugcu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-96 repressed the expression of IRS-1 by targeting IRS-1 3'UTR directly. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| Representative Target(s) Regulated by This miRNA |
5-HT 1B receptor (HTR1B)
|
Target Info
|
|
|
ALK tyrosine kinase receptor (ALK)
|
Target Info
|
|
| References |
Top |
| REF 1 |
The induction of miR-96 by mitochondrial dysfunction causes impaired glycogen synthesis through translational repression of IRS-1 in SK-Hep1 cells. Biochem Biophys Res Commun. 2013 May 10;434(3):503-8.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
