Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T47768 |
Target Info
|
| Target Name |
Opioid receptor mu (MOP) |
| Synonyms |
hMOP; Mu-type opioid receptor; Mu opioid receptor; Mu opiate receptor; MOR1A; MOR1; MOR-1; M-OR-1 |
| Target Type |
Successful Target |
| Gene Name |
OPRM1 |
| Biochemical Class |
GPCR rhodopsin |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-107 |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
agcagcauuguacagggcuauca
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-107 functions as a repressor to regulate luciferase activity through the predicted miR-103/107 binding sites in the MOR-1A 3'UTR. |
[1] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
qRT-PCR |
[1] |
| Representative Target(s) Regulated by This miRNA |
Beta-secretase 1 (BACE1)
|
Target Info
|
|
|
Caveolin 1 (CAV1)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-134-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
ugugacugguugaccagagggg
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
MOR1-3'UTR was targeted by miR-134, negatively regulating MOR1 expression. |
[2] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Immunoblot; Immunohistochemistry; In Situ Hybridization; Luciferase Reporter Assay |
[2] |
| Representative Target(s) Regulated by This miRNA |
Angiopoietin-related protein 4 (ANGPTL4)
|
Target Info
|
|
|
Erbb2 tyrosine kinase receptor (HER2)
|
Target Info
|
|
| References |
Top |
| REF 1 |
Morphine regulates expression of -opioid receptor MOR-1A, an intron-retention carboxyl terminal splice variant of the -opioid receptor (OPRM1) gene via miR-103/miR-107. Mol Pharmacol. 2014 Feb;85(2):368-80.
|
| REF 2 |
Regulation of -opioid type 1 receptors by microRNA134 in dorsal root ganglion neurons following peripheral inflammation. Eur J Pain. 2013 Mar;17(3):313-23.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
