Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T49085 Target Info
Target Name Transcription factor SOX-5 (SOX5)
Synonyms SRY-box 5; LAMSHF; L-SOX5F; L-SOX5B; L-SOX5
Target Type Literature-reported Target
Gene Name SOX5
UniProt ID
P35711
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-15a-5p miRNA Info
miRNA Mature AC
MIMAT0000068
Sequence uagcagcacauaaugguuugug
miRNA Species Homo sapiens
Regulation Mechanism SOX5 is a direct target of miR-15a-3p. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [3]
2 Luciferase Reporter Assay; Western Blot; Northern Blot; qRT-PCR [4]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-132-3p miRNA Info
miRNA Mature AC
MIMAT0000426
Sequence uaacagucuacagccauggucg
miRNA Species Homo sapiens
Regulation Mechanism SOX5 is a direct target of miR-132-3p. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
Cyclin A2 (CCNA2) Target Info
CCNA2_HUMAN
References  Top
REF 1 Krpel-like factor 9 inhibits glioma cell proliferation and tumorigenicity via downregulation of miR-21. Cancer Lett. 2015 Jan 28;356(2 Pt B):547-55.
REF 2 Circular RNA DOCK1 promotes bladder carcinoma progression via modulating circDOCK1/hsa-miR-132-3p/Sox5 signalling pathway. Cell Prolif. 2019 Jul;52(4):e12614.
REF 3 MicroRNA-21a-5p Functions on the Regulation of Melanogenesis by Targeting Sox5 in Mouse Skin Melanocytes. Int J Mol Sci. 2016 Jun 24;17(7). pii: E959.
REF 4 MicroRNA-21 down-regulates the expression of tumor suppressor PDCD4 in human glioblastoma cell T98G. Cancer Lett. 2008 Dec 18;272(2):197-205.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.