miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-132-3p | ||||
| miRNA Stemloop AC | MI0000449 | ||||
| miRNA Stemloop ID | hsa-mir-132 | ||||
| Sequence | uaacagucuacagccauggucg | ||||
| TTD Target(s) Regulated by This miRNA | Epidermal growth factor receptor (EGFR) | Successful Target | Target Info | [1] | |
| Fibroblast growth factor-2 (FGF2) | Successful Target | Target Info | [2] | ||
| Matrix metalloproteinase-9 (MMP-9) | Clinical trial Target | Target Info | [3] | ||
| Extracellular signal-regulated kinase 2 (ERK2) | Clinical trial Target | Target Info | [4] | ||
| NAD-dependent deacetylase sirtuin-1 (SIRT1) | Clinical trial Target | Target Info | [5] | ||
| Growth/differentiation factor 5 (GDF-5) | Clinical trial Target | Target Info | [6] | ||
| Proheparin-binding EGF-like growth factor (HBEGF) | Clinical trial Target | Target Info | [7] | ||
| Proto-oncogene c-RAF (c-RAF) | Clinical trial Target | Target Info | [1] | ||
| Renal carcinoma antigen NY-REN-64 (IRAK-4) | Clinical trial Target | Target Info | [8] | ||
| Brain-derived neurotrophic factor (BDNF) | Clinical trial Target | Target Info | [9] | ||
| G2/mitotic-specific cyclin B1 (CCNB1) | Patented-recorded Target | Target Info | [10] | ||
| Cyclin A2 (CCNA2) | Literature-reported Target | Target Info | [10] | ||
| Proto-oncogene c-Crk (c-Crk) | Literature-reported Target | Target Info | [7] | ||
| Forkhead box protein O1A (FOXO1) | Literature-reported Target | Target Info | [11] | ||
| HepG2 glucose transporter (SLC2A1) | Preclinical Target | Target Info | [12] | ||
| GTPase activating protein (RASA1) | Literature-reported Target | Target Info | [13] | ||
| Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [14] | ||
| Hepatocellular carcinoma-associated protein (HCAP) | Literature-reported Target | Target Info | [15] | ||
| Transcription factor SOX-5 (SOX5) | Literature-reported Target | Target Info | [16] | ||
| Protein(s) Regulated by This miRNA | Jupiter microtubule associated homolog 1 | Regulated Protein | [4] | ||
| Kelch-like protein 11 | Regulated Protein | [4] | |||
| Mothers against decapentaplegic homolog 2 | Regulated Protein | [18] | |||
| Mucin-13 | Regulated Protein | [19] | |||
| Phosphatidylinositol 3-kinase regulatory subunit gamma | Regulated Protein | [20] | |||
| Protein argonaute-2 | Regulated Protein | [21] | |||
| Protein sprouty homolog 1 | Regulated Protein | [22] | |||
| Retinoblastoma-associated protein | Regulated Protein | [10] | |||
| Rho GTPase-activating protein 32 | Regulated Protein | [24] | |||
| Sprouty-related, EVH1 domain-containing protein 1 | Regulated Protein | [22] | |||
| Talin-2 | Regulated Protein | [25] | |||
| Tight junction-associated protein 1 | Regulated Protein | [26] | |||
| Transcription factor SOX-4 | Regulated Protein | [27] | |||
| Transcription factor SOX-6 | Regulated Protein | [6] | |||
| References | |||||
| REF 1 | MicroRNA-7 as a tumor suppressor and novel therapeutic for adrenocortical carcinoma. Oncotarget. 2015 Nov 3;6(34):36675-88. | ||||
| REF 2 | An endothelial apelin-FGF link mediated by miR-424 and miR-503 is disrupted in pulmonary arterial hypertension. Nat Med. 2013 Jan;19(1):74-82. | ||||
| REF 3 | miR-132 Regulates Dendritic Spine Structure by Direct Targeting of Matrix Metalloproteinase 9 mRNA. Mol Neurobiol. 2016 Sep;53(7):4701-12. | ||||
| REF 4 | Rapid regulation of microRNA following induction of long-term potentiation in vivo. Front Mol Neurosci. 2014 Dec 9;7:98. | ||||
| REF 5 | MicroRNA 132 regulates nutritional stress-induced chemokine production through repression of SirT1. Mol Endocrinol. 2009 Nov;23(11):1876-84. | ||||
| REF 6 | MiR-132-3p Regulates the Osteogenic Differentiation of Thoracic Ligamentum Flavum Cells by Inhibiting Multiple Osteogenesis-Related Genes. Int J Mol Sci. 2016 Aug 20;17(8). pii: E1370. | ||||
| REF 7 | MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105. | ||||
| REF 8 | Regulation of TLR2-mediated tolerance and cross-tolerance through IRAK4 modulation by miR-132 and miR-212. J Immunol. 2013 Feb 1;190(3):1250-63. | ||||
| REF 9 | Alterations of serum levels of BDNF-related miRNAs in patients with depression. PLoS One. 2013 May 21;8(5):e63648. | ||||
| REF 10 | miR-132 and miR-212 are increased in pancreatic cancer and target the retinoblastoma tumor suppressor. Biochem Biophys Res Commun. 2011 Mar 25;406(4):518-23. | ||||
| REF 11 | miR-132 upregulation promotes gastric cancer cell growth through suppression of FoxO1 translation. Tumour Biol. 2015 Aug 23. [Epub ahead of print] | ||||
| REF 12 | miR-132 mediates a metabolic shift in prostate cancer cells by targeting Glut1. FEBS Open Bio. 2016 Jun 8;6(7):735-41. | ||||
| REF 13 | Transplantation of human pericyte progenitor cells improves the repair of infarcted heart through activation of an angiogenic program involving micro-RNA-132. Circ Res. 2011 Sep 30;109(8):894-906. | ||||
| REF 14 | Multiple microRNAs modulate p21Cip1/Waf1 expression by directly targeting its 3' untranslated region. Oncogene. 2010 Apr 15;29(15):2302-8. | ||||
| REF 15 | Hsa-miR-132 inhibits proliferation of hepatic carcinoma cells by targeting YAP. Cell Biochem Funct. 2015 Jul;33(5):326-33. | ||||
| REF 16 | Krpel-like factor 9 inhibits glioma cell proliferation and tumorigenicity via downregulation of miR-21. Cancer Lett. 2015 Jan 28;356(2 Pt B):547-55. | ||||
| REF 17 | Rapid regulation of microRNA following induction of long-term potentiation in vivo. Front Mol Neurosci. 2014 Dec 9;7:98. | ||||
| REF 18 | miR-212/132 downregulates SMAD2 expression to suppress the G1/S phase transition of the cell cycle and the epithelial to mesenchymal transition in cervical cancer cells.IUBMB Life. 2015 May;67(5):380-94. | ||||
| REF 19 | Reduction of miR 32 p contributes to gastric cancer proliferation by targeting MUC13.Mol Med Rep. 2017 May;15(5):3055-3061. | ||||
| REF 20 | MiR-132 inhibits cell proliferation, invasion and migration of hepatocellular carcinoma by targeting PIK3R3.Int J Oncol. 2015 Oct;47(4):1585-93. | ||||
| REF 21 | Suppression of AGO2 by miR-132 as a determinant of miRNA-mediated silencing in human primary endothelial cells.Int J Biochem Cell Biol. 2015 Dec;69:75-84. | ||||
| REF 22 | MicroRNA-132/212 family enhances arteriogenesis after hindlimbschaemia through modulation of the Ras-MAPK pathway.J Cell Mol Med. 2015 Aug;19(8):1994-2005. | ||||
| REF 23 | miR-132 and miR-212 are increased in pancreatic cancer and target the retinoblastoma tumor suppressor. Biochem Biophys Res Commun. 2011 Mar 25;406(4):518-23. | ||||
| REF 24 | A microRNA-based gene dysregulation pathway in Huntington's disease. Neurobiol Dis. 2008 Mar;29(3):438-45. | ||||
| REF 25 | DNA methylation silences miR-132 in prostate cancer. Oncogene. 2013 Jan 3;32(1):127-34. | ||||
| REF 26 | Capturing microRNA targets using an RNA-induced silencing complex (RISC)-trap approach. Proc Natl Acad Sci U S A. 2012 Dec 11;109(50):20473-8. | ||||
| REF 27 | Aryl hydrocarbon receptor-microRNA-212/132 axis in human breast cancer suppresses metastasis by targeting SOX4.Mol Cancer. 2015 Sep 17;14:172. | ||||
| REF 28 | MiR-132-3p Regulates the Osteogenic Differentiation of Thoracic Ligamentum Flavum Cells by Inhibiting Multiple Osteogenesis-Related Genes. Int J Mol Sci. 2016 Aug 20;17(8). pii: E1370. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.