Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T49453 Target Info
Target Name Notch-4 receptor (NOTCH4)
Synonyms hNotch4; Notch 4; Neurogenic locus notch homolog protein 4; INT3
Target Type Clinical trial Target
Gene Name NOTCH4
Biochemical Class Notch protein
UniProt ID
Q99466
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-181c-5p miRNA Info
miRNA Mature AC
MIMAT0000258
Sequence aacauucaaccugucggugagu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-181c-5p by mature miRNA precursor transfection resulted in the decreased protein level of target NOTCH4. [1]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [1]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
miRNA Mature ID hsa-miR-34c-5p miRNA Info
miRNA Mature AC
MIMAT0000686
Sequence aggcaguguaguuagcugauugc
miRNA Species Homo sapiens
Regulation Mechanism Ectopic expression of miR-34c reduced the self-renewal of BT-ICs, inhibited epithelial-mesenchymal transition, and suppressed migration of the tumor cells via silencing target gene Notch4. [2]
Evidence Score (E-score) 1 +
1 EMSA; Luciferase Reporter Assay; Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
References  Top
REF 1 Involvement of epigenetically silenced microRNA-181c in gastric carcinogenesis. Carcinogenesis. 2010 May;31(5):777-84.
REF 2 MicroRNA 34c gene down-regulation via DNA methylation promotes self-renewal and epithelial-mesenchymal transition in breast tumor-initiating cells. J Biol Chem. 2012 Jan 2;287(1):465-73.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.