miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-34c-5p
miRNA Stemloop AC MI0000743
miRNA Stemloop ID hsa-mir-34c
Sequence aggcaguguaguuagcugauugc
TTD Target(s) Regulated by This miRNA Platelet-derived growth factor receptor alpha (PDGFRA) Successful Target Target Info [1]
Cyclin-dependent kinase 4 (CDK4) Successful Target Target Info [2]
Heat shock protein 90 alpha (HSP90A) Successful Target Target Info [3]
Platelet-derived growth factor receptor beta (PDGFRB) Successful Target Target Info [1]
Proto-oncogene c-Met (MET) Successful Target Target Info [2]
Apoptosis regulator Bcl-2 (BCL-2) Successful Target Target Info [4]
GABA(A) receptor alpha-3 (GABRA3) Successful Target Target Info [5]
Retinoic acid receptor gamma (RARG) Successful Target Target Info [6]
Tyrosine-protein kinase UFO (AXL) Successful Target Target Info [7]
Gamma-aminobutyric acid B receptor (GABBR) Successful Target Target Info [5]
ERK activator kinase 1 (MEK1) Clinical trial Target Target Info [8]
Synuclein alpha (SNCA) Clinical trial Target Target Info [9]
Microtubule-associated protein tau (MAPT) Clinical trial Target Target Info [10]
Notch-1 receptor (NOTCH1) Clinical trial Target Target Info [11]
Notch-4 receptor (NOTCH4) Clinical trial Target Target Info [12]
Metabotropic glutamate receptor 7 (mGluR7) Literature-reported Target Target Info [5]
Proto-oncogene c-Myc (MYC) Literature-reported Target Target Info [13]
Tyrosine-protein kinase ZAP-70 (ZAP-70) Patented-recorded Target Target Info [14]
Hepatocyte nuclear factor 4-alpha (HNF4A) Literature-reported Target Target Info [15]
Epithelial cadherin (CDH1) Literature-reported Target Target Info [3]
Fos-related antigen 1 (FOSL1) Literature-reported Target Target Info [16]
IP3 receptor isoform 1 (ITPR1) Literature-reported Target Target Info [8]
N-myc proto-oncogene protein (MYCN) Literature-reported Target Target Info [17]
Transcription factor SOX-2 (SOX2) Literature-reported Target Target Info [17]
G1/S-specific cyclin-E2 (CCNE2) Literature-reported Target Target Info [2]
Runt-related transcription factor 2 (RUNX2) Literature-reported Target Target Info [18]
Protein(s) Regulated by This miRNA ARF GTPase-activating protein GIT1 Regulated Protein
GIT1_HUMAN
[19]
Bcl-2-modifying factor Regulated Protein
BMF_HUMAN
[20]
Homeobox protein NANOG Regulated Protein
NANOG_HUMAN
[17]
Homeobox protein TGIF2 Regulated Protein
TGIF2_HUMAN
[22]
Interleukin-6 receptor subunit alpha Regulated Protein
IL6RA_HUMAN
[23]
Mucin-2 Regulated Protein
MUC2_HUMAN
[24]
Myc-associated zinc finger protein Regulated Protein
MAZ_HUMAN
[25]
N-acetylgalactosaminyltransferase 7 Regulated Protein
GALT7_HUMAN
[26]
Polyadenylate-binding protein 1 Regulated Protein
PABP1_HUMAN
[27]
Tight junction protein ZO-1 Regulated Protein
ZO1_HUMAN
[28]
Transcriptional repressor protein YY1 Regulated Protein
TYY1_HUMAN
[29]
UL16-binding protein 2 Regulated Protein
ULBP2_HUMAN
[30]
Uracil-DNA glycosylase Regulated Protein
UNG_HUMAN
[31]
Vezatin Regulated Protein
VEZA_HUMAN
[32]
Zinc finger protein SNAI1 Regulated Protein
SNAI1_HUMAN
[33]
References
REF 1 MiR-34a/c-Dependent PDGFR-/ Downregulation Inhibits Tumorigenesis and Enhances TRAIL-Induced Apoptosis in Lung Cancer. PLoS One. 2013 Jun 21;8(6):e67581.
REF 2 The miR-34 family in cancer and apoptosis. Cell Death Differ. 2010 Feb;17(2):193-9.
REF 3 Genome-wide analyses of radioresistance-associated miRNA expression profile in nasopharyngeal carcinoma using next generation deep sequencing. PLoS One. 2013 Dec 19;8(12):e84486.
REF 4 Restoration of tumor suppressor miR-34 inhibits human p53-mutant gastric cancer tumorspheres. BMC Cancer. 2008 Sep 21;8:266.
REF 5 SOX11 identified by target gene evaluation of miRNAs differentially expressed in focal and non-focal brain tissue of therapy-resistant epilepsy patients. Neurobiol Dis. 2015 May;77:127-40.
REF 6 MIR-34c regulates mouse embryonic stem cells differentiation into male germ-like cells through RARg. Cell Biochem Funct. 2012 Dec;30(8):623-32.
REF 7 The Axl-Regulating Tumor Suppressor miR-34a Is Increased in ccRCC but Does Not Correlate with Axl mRNA or Axl Protein Levels. PLoS One. 2015 Aug 19;10(8):e0135991.
REF 8 The changes of miRNA expression in rat hippocampus following chronic lead exposure. Toxicol Lett. 2014 Aug 17;229(1):158-66.
REF 9 Inhibition of miR-34b and miR-34c enhances -synuclein expression in Parkinson's disease. FEBS Lett. 2015 Jan 30;589(3):319-25.
REF 10 Regulation of microtubule-associated protein tau (MAPT) by miR-34c-5p determines the chemosensitivity of gastric cancer to paclitaxel. Cancer Chemother Pharmacol. 2013 May;71(5):1159-71.
REF 11 miRNA-34c regulates Notch signaling during bone development. Hum Mol Genet. 2012 Jul 1;21(13):2991-3000.
REF 12 MicroRNA 34c gene down-regulation via DNA methylation promotes self-renewal and epithelial-mesenchymal transition in breast tumor-initiating cells. J Biol Chem. 2012 Jan 2;287(1):465-73.
REF 13 Prediction and preliminary validation of oncogene regulation by miRNAs. BMC Mol Biol. 2007 Sep 18;8:79.
REF 14 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
REF 15 The role of microRNAs in hepatocyte nuclear factor-4alpha expression and transactivation. Biochim Biophys Acta. 2013 May;1829(5):436-42.
REF 16 MicroRNA-34 suppresses breast cancer invasion and metastasis by directly targeting Fra-1. Oncogene. 2013 Sep 5;32(36):4294-303.
REF 17 miR-34 miRNAs provide a barrier for somatic cell reprogramming. Nat Cell Biol. 2011 Oct 23;13(11):1353-60.
REF 18 MicroRNA-34c inversely couples the biological functions of the runt-related transcription factor RUNX2 and the tumor suppressor p53 in osteosarcoma. J Biol Chem. 2013 Jul 19;288(29):21307-19.
REF 19 MicroRNA-34c Suppresses Breast Cancer Migration and Invasion by Targeting GIT1. J Cancer. 2016 Jul 25;7(12):1653-1662.
REF 20 miR-34c may protect lung cancer cells from paclitaxel-induced apoptosis.Oncogene. 2013 Jan 17;32(3):341-51.
REF 21 miR-34 miRNAs provide a barrier for somatic cell reprogramming. Nat Cell Biol. 2011 Oct 23;13(11):1353-60.
REF 22 MicroRNA-34c targets TGFB-induced factor homeobox 2, represses cell proliferation and induces apoptosis in hepatitis B virus-related hepatocellular... Oncol Lett. 2015 Nov;10(5):3095-3102.
REF 23 IL-6R/STAT3/miR-34a feedback loop promotes EMT-mediated colorectal cancer invasion and metastasis.J Clin Invest. 2014 Apr;124(4):1853-67.
REF 24 Helicobacter pylori infection related long noncoding RNA (lncRNA) AF147447 inhibits gastric cancer proliferation and invasion by targeting MUC2 and up-regulating miR-34c.Oncotarget. 2016 Dec 13;7(50):82770-82782.
REF 25 miR-34c regulates the permeability of blood-tumor barrier via MAZ-mediated expression changes of ZO-1, occludin, and claudin-5.J Cell Physiol. 2015 Mar;230(3):716-31.
REF 26 MicroRNA 4a/c function as tumor suppressors in Hep laryngeal carcinoma cells and may reduce GALNT7 expression.Mol Med Rep. 2014 Apr;9(4):1293-8.
REF 27 PABPC1 exerts carcinogenesis in gastric carcinoma by targeting miR-34c. Int J Clin Exp Pathol. 2015 Apr 1;8(4):3794-802.
REF 28 MiR-34c and PlncRNA1 mediated the function of intestinal epithelial barrier by regulating tight junction proteins in inflammatory bowel disease.Biochem Biophys Res Commun. 2017 Apr 22;486(1):6-13.
REF 29 Yin Yang 1 is a target of microRNA-34 family and contributes to gastric carcinogenesis.Oncotarget. 2014 Jul 15;5(13):5002-16.
REF 30 Tumor suppressive microRNAs miR-34a/c control cancer cell expression of ULBP2, a stress-induced ligand of the natural killer cell receptor NKG2D.Cancer Res. 2012 Jan 15;72(2):460-71.
REF 31 Multiple microRNAs may regulate the DNA repair enzyme uracil-DNA glycosylase.DNA Repair (Amst). 2013 Jan 1;12(1):80-6.
REF 32 Down-regulation of VEZT gene expression in human gastric cancer involves promoter methylation and miR-43c.Biochem Biophys Res Commun. 2011 Jan 14;404(2):622-7.
REF 33 miR-34 and SNAIL form a double-negative feedback loop to regulate epithelial-mesenchymal transitions.Cell Cycle. 2011 Dec 15;10(24):4256-71.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.