Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T49898 Target Info
Target Name Cyclin-dependent kinase 1 (CDK1)
Synonyms P34CDC2; P34 protein kinase; CDKN1; CDC28A; CDC2
Target Type Clinical trial Target
Gene Name CDK1
Biochemical Class Kinase
UniProt ID
P06493
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-31-5p miRNA Info
miRNA Mature AC
MIMAT0000089
Sequence aggcaagaugcuggcauagcu
miRNA Species Homo sapiens
Regulation Mechanism miR-31 directly targets CDK1. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 1 (CDK1) Target Info
CDK1_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
miRNA Mature ID hsa-miR-302a-3p miRNA Info
miRNA Mature AC
MIMAT0000684
Sequence uaagugcuuccauguuuugguga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [3]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cyclin-dependent kinase 1 (CDK1) Target Info
CDK1_HUMAN
miRNA Mature ID hsa-miR-663a miRNA Info
miRNA Mature AC
MIMAT0003326
Sequence aggcggggcgccgcgggaccgc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [4]
Representative Target(s) Regulated by This miRNA C-X-C chemokine receptor type 4 (CXCR4) Target Info
CXCR4_HUMAN
CCAAT/enhancer binding protein beta (CEBPB) Target Info
CEBPB_HUMAN
References  Top
REF 1 Epigenetic repression of miR-31 disrupts androgen receptor homeostasis and contributes to prostate cancer progression. Cancer Res. 2013 Feb 1;73(3):1232-44.
REF 2 LncRNA PVT1 regulates growth, migration, and invasion of bladder cancer by miR-31/ CDK1. J Cell Physiol. 2019 Apr;234(4):4799-4811.
REF 3 MicroRNA miR-302 inhibits the tumorigenicity of endometrial cancer cells by suppression of Cyclin D1 and CDK1. Cancer Lett. 2014 Apr 1;345(1):39-47.
REF 4 Tumor-suppressive mir-663 gene induces mitotic catastrophe growth arrest in human gastric cancer cells. Oncol Rep. 2010 Jul;24(1):105-12.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.