Target Regulator(s) Information (MicroRNA)
Target General Information | Top | ||||
---|---|---|---|---|---|
Target ID | T51115 | Target Info | |||
Target Name | Voltage-gated calcium channel alpha Cav1.2 (CACNA1C) | ||||
Synonyms | Voltage-gated calcium channel subunit alpha Cav1.2; Voltage-dependent L-type calcium channel subunit alpha-1C; Calcium channel, L type, alpha-1 polypeptide, isoform 1, cardiac muscle; CCHL1A1; CACNL1A1; CACN2; CACH2 | ||||
Target Type | Successful Target | ||||
Gene Name | CACNA1C | ||||
Biochemical Class | Voltage-gated ion channel | ||||
UniProt ID |
The microRNAs (miRNAs) Regulating This Target | Top | ||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-208a-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | auaagacgagcaaaaagcuugu | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 2 | + | |||
1 | Luciferase Reporter Assay | [1] | |||
2 | Western Blot | [2] | |||
Representative Target(s) Regulated by This miRNA | Melanoma differentiation-associated protein 6 (CDKN1A) | Target Info | |||
Protein C-ets-1 (ETS1) | Target Info | ||||
miRNA Mature ID | hsa-miR-29a-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | uagcaccaucugaaaucgguua | ||||
miRNA Species | Homo sapiens | ||||
Regulation Mechanism | CACNA1C is negatively regulated by miR-29a-3p . | [3] | |||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay; Western Blot | [3] | |||
Representative Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-2 (BCL-2) | Target Info | |||
Aryl hydrocarbon receptor (AHR) | Target Info | ||||
miRNA Mature ID | hsa-miR-208b-3p | miRNA Info | |||
miRNA Mature AC | |||||
Sequence | auaagacgaacaaaagguuugu | ||||
miRNA Species | Homo sapiens | ||||
Evidence Score (E-score) | 1 | + | |||
1 | Luciferase Reporter Assay | [1] | |||
Representative Target(s) Regulated by This miRNA | Melanoma differentiation-associated protein 6 (CDKN1A) | Target Info | |||
Voltage-gated calcium channel alpha Cav1.2 (CACNA1C) | Target Info |
References | Top | ||||
---|---|---|---|---|---|
REF 1 | miR-208b upregulation interferes with calcium handling in HL-1 atrial myocytes: Implications in human chronic atrial fibrillation. J Mol Cell Cardiol. 2016 Oct;99:162-173. | ||||
REF 2 | MicroRNAs in Atrial Fibrillation: from Expression Signatures to Functional Implications. Cardiovasc Drugs Ther. 2017 Jun;31(3):345-365. | ||||
REF 3 | Underexpression of CACNA1C Caused by Overexpression of microRNA-29a Underlies the Pathogenesis of Atrial Fibrillation. Med Sci Monit. 2016 Jun 24;22:2175-81. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.