Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T51115 Target Info
Target Name Voltage-gated calcium channel alpha Cav1.2 (CACNA1C)
Synonyms Voltage-gated calcium channel subunit alpha Cav1.2; Voltage-dependent L-type calcium channel subunit alpha-1C; Calcium channel, L type, alpha-1 polypeptide, isoform 1, cardiac muscle; CCHL1A1; CACNL1A1; CACN2; CACH2
Target Type Successful Target
Gene Name CACNA1C
Biochemical Class Voltage-gated ion channel
UniProt ID
Q13936
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-208a-3p miRNA Info
miRNA Mature AC
MIMAT0000241
Sequence auaagacgagcaaaaagcuugu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
Representative Target(s) Regulated by This miRNA Melanoma differentiation-associated protein 6 (CDKN1A) Target Info
CDN1A_HUMAN
Protein C-ets-1 (ETS1) Target Info
ETS1_HUMAN
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism CACNA1C is negatively regulated by miR-29a-3p . [3]
Evidence Score (E-score) 1 +
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
miRNA Mature ID hsa-miR-208b-3p miRNA Info
miRNA Mature AC
MIMAT0004960
Sequence auaagacgaacaaaagguuugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
Representative Target(s) Regulated by This miRNA Melanoma differentiation-associated protein 6 (CDKN1A) Target Info
CDN1A_HUMAN
Voltage-gated calcium channel alpha Cav1.2 (CACNA1C) Target Info
CAC1C_HUMAN
References  Top
REF 1 miR-208b upregulation interferes with calcium handling in HL-1 atrial myocytes: Implications in human chronic atrial fibrillation. J Mol Cell Cardiol. 2016 Oct;99:162-173.
REF 2 MicroRNAs in Atrial Fibrillation: from Expression Signatures to Functional Implications. Cardiovasc Drugs Ther. 2017 Jun;31(3):345-365.
REF 3 Underexpression of CACNA1C Caused by Overexpression of microRNA-29a Underlies the Pathogenesis of Atrial Fibrillation. Med Sci Monit. 2016 Jun 24;22:2175-81.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.