Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T52189 Target Info
Target Name ATP-citrate synthase (ACLY)
Synonyms Citrate cleavage enzyme; ATP-citrate (pro-S-)-lyase; ACL
Target Type Successful Target
Gene Name ACLY
Biochemical Class Acyltransferase
UniProt ID
P53396
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-22-3p miRNA Info
miRNA Mature AC
MIMAT0000077
Sequence aagcugccaguugaagaacugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [1]
Representative Target(s) Regulated by This miRNA 5-HT 2C receptor (HTR2C) Target Info
5HT2C_HUMAN
ATP-citrate synthase (ACLY) Target Info
ACLY_HUMAN
References  Top
REF 1 miR-22 inhibits tumor growth and metastasis by targeting ATP citrate lyase: evidence in osteosarcoma, prostate cancer, cervical cancer and lung cancer. Oncotarget. 2016 Jul 12;7(28):44252-44265.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.