Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T53952 Target Info
Target Name Homeodomain interacting protein kinase 2 (HIPK2)
Synonyms hHIPk2; Homeodomain-interacting protein kinase 2
Target Type Literature-reported Target
Gene Name HIPK2
Biochemical Class Kinase
UniProt ID
Q9H2X6
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-141-3p miRNA Info
miRNA Mature AC
MIMAT0000432
Sequence uaacacugucugguaaagaugg
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Bromodomain-containing protein 3 (BRD3) Target Info
BRD3_HUMAN
miRNA Mature ID hsa-miR-27a-3p miRNA Info
miRNA Mature AC
MIMAT0000084
Sequence uucacaguggcuaaguuccgc
miRNA Species Homo sapiens
Regulation Mechanism HIPK2, tumor suppressor, was regarded as a target gene of miR-27a. [3]
Evidence Score (E-score) 1 +
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-934 miRNA Info
miRNA Mature AC
MIMAT0004977
Sequence ugucuacuacuggagacacugg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
Representative Target(s) Regulated by This miRNA Homeodomain interacting protein kinase 2 (HIPK2) Target Info
HIPK2_HUMAN
References  Top
REF 1 Role of miR-27a, miR-181a and miR-20b in gastric cancer hypoxia-induced chemoresistance. Cancer Biol Ther. 2016 Apr 2;17(4):400-6.
REF 2 miR-141 regulates TGF-1-induced epithelial-mesenchymal transition through repression of HIPK2 expression in renal tubular epithelial cells. Int J Mol Med. 2015 Feb;35(2):311-8.
REF 3 MiR-27a modulates MDR1/P-glycoprotein expression by targeting HIPK2 in human ovarian cancer cells. Gynecol Oncol. 2010 Oct;119(1):125-30.
REF 4 Alcohol-dysregulated miR-30a and miR-934 in head and neck squamous cell carcinoma. Mol Cancer. 2015 Oct 15;14:181.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.