Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T55729 Target Info
Target Name Stress-activated protein kinase 2b (p38 beta)
Synonyms Stress-activated protein kinase-2; SAPK2b; SAPK2; PRKM11; P38b; P38-2; P38 Mitogen-activated protein kinase beta; Mitogen-activated protein kinase p38 beta; Mitogen-activated protein kinase 11; MAPK 11; MAP kinase p38 beta; MAP kinase 11
Target Type Clinical trial Target
Gene Name MAPK11
Biochemical Class Kinase
UniProt ID
Q15759
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-122-5p miRNA Info
miRNA Mature AC
MIMAT0000421
Sequence uggagugugacaaugguguuug
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR [1]
2 qRT-PCR [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
References  Top
REF 1 MicroRNA-122, a tumor suppressor microRNA that regulates intrahepatic metastasis of hepatocellular carcinoma. Hepatology. 2009 May;49(5):1571-82.
REF 2 Involvement of MicroRNAs in Probiotics-Induced Reduction of the Cecal Inflammation by Salmonella Typhimurium. Front Immunol. 2017 Jun 13;8:704.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.