Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T56418 |
Target Info
|
| Target Name |
ALK tyrosine kinase receptor (ALK) |
| Synonyms |
CD246; Anaplastic lymphoma kinase |
| Target Type |
Successful Target |
| Gene Name |
ALK |
| Biochemical Class |
Kinase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-96-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uuuggcacuagcacauuuuugcu
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-96 potentially binds with the ALK 3'untranslated region. miR-96 levels were markedly decreased in ALK expressing cancer cell lines and primary human tumors compared with their normal cellular and tissue counterparts. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[1] |
| 2 |
qPCR |
[2] |
| Representative Target(s) Regulated by This miRNA |
5-HT 1B receptor (HTR1B)
|
Target Info
|
|
|
ALK tyrosine kinase receptor (ALK)
|
Target Info
|
|
| References |
Top |
| REF 1 |
MicroRNA 96 is a post-transcriptional suppressor of anaplastic lymphoma kinase expression. Am J Pathol. 2012 May;180(5):1772-80.
|
| REF 2 |
Genome-wide screening identifies oncofetal lncRNA Ptn-dt promoting the proliferation of hepatocellular carcinoma cells by regulating the Ptn receptor. Oncogene. 2019 May;38(18):3428-3445.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
