Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T61729 |
Target Info
|
| Target Name |
Prolyl 4-hydroxylasesubunit alpha-1 (P4HA1) |
| Synonyms |
Prolyl 4-hydroxylase subunit alpha-1; Procollagenproline,2oxoglutarate4dioxygenase subunit alpha1; Procollagen-proline,2-oxoglutarate-4-dioxygenase subunit alpha-1; P4HA; 4PH alpha1; 4-PH alpha-1 |
| Target Type |
Clinical trial Target |
| Gene Name |
P4HA1 |
| Biochemical Class |
Paired donor oxygen oxidoreductase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-122-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uggagugugacaaugguguuug
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-122 downregulates the expression of P4HA1 via targeting the 3'UTR of P4HA1 mRNA. |
[1] |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay |
[1] |
| 2 |
Western Blot |
[2] |
| Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-W (BCL-W)
|
Target Info
|
|
|
Apoptosis regulator Bcl-xL (BCL-xL)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-30e-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uguaaacauccuugacuggaag
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-30e suppresses proliferation of hepatoma cells via targeting prolyl 4-hydroxylase subunit alpha-1 (P4HA1) mRNA. |
[3] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Luciferase Reporter Assay; Western Blot |
[3] |
| Representative Target(s) Regulated by This miRNA |
Caspase-3 (CASP3)
|
Target Info
|
|
|
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
| References |
Top |
| REF 1 |
miR-122 regulates collagen production via targeting hepatic stellate cells and suppressing P4HA1 expression. J Hepatol. 2013 Mar;58(3):522-8.
|
| REF 2 |
MiR-122 modification enhances the therapeutic efficacy of adipose tissue-derived mesenchymal stem cells against liver fibrosis. J Cell Mol Med. 2017 Nov;21(11):2963-2973.
|
| REF 3 |
MiR-30e suppresses proliferation of hepatoma cells via targeting prolyl 4-hydroxylase subunit alpha-1 (P4HA1) mRNA. Biochem Biophys Res Commun. 2016 Apr 8;472(3):516-22.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
