Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T63505 Target Info
Target Name Tyrosine-protein kinase ABL1 (ABL)
Synonyms p150; Proto-oncogene tyrosine-protein kinase ABL1; Proto-oncogene c-Abl; JTK7; C-ABL; Abl; Abelson tyrosine-protein kinase 1; Abelson murine leukemia viral oncogene homolog 1
Target Type Successful Target
Gene Name ABL1
Biochemical Class Kinase
UniProt ID
P00519
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-203a-3p miRNA Info
miRNA Mature AC
MIMAT0000264
Sequence gugaaauguuuaggaccacuag
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-203a-3p resulted in the decreased protein level of target ABL1. [1]
Evidence Score (E-score) 3 +
1 Immunoblot; Luciferase Reporter Assay [1]
2 Immunoprecipitation; qRT-PCR; Western Blot [2]
3 qRT-PCR; Western Blot [3]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-4723-5p miRNA Info
miRNA Mature AC
MIMAT0019838
Sequence ugggggagccaugagauaagagca
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [4]
2 PAR-CLIP [5]
Representative Target(s) Regulated by This miRNA Tyrosine-protein kinase ABL1 (ABL) Target Info
ABL1_HUMAN
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism miR-29b regulates ABL1 by binding to its 3'UTR. [6]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [6]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
miRNA Mature ID hsa-miR-30a-5p miRNA Info
miRNA Mature AC
MIMAT0000087
Sequence uguaaacauccucgacuggaag
miRNA Species Homo sapiens
Regulation Mechanism BCR-ABL1 is a target of the microRNA miR-30a. [7]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [7]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
References  Top
REF 1 Genetic and epigenetic silencing of microRNA-203 enhances ABL1 and BCR-ABL1 oncogene expression. Cancer Cell. 2008 Jun;13(6):496-506.
REF 2 ING1b-inducible microRNA203 inhibits cell proliferation. Br J Cancer. 2013 Mar 19;108(5):1143-8.
REF 3 Hyper-methylated miR-203 dysregulates ABL1 and contributes to the nickel-induced tumorigenesis. Toxicol Lett. 2013 Oct 23;223(1):42-51.
REF 4 MicroRNA-4723 inhibits prostate cancer growth through inactivation of the Abelson family of nonreceptor protein tyrosine kinases. PLoS One. 2013 Nov 1;8(11):e78023.
REF 5 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 6 miR-29b suppresses CML cell proliferation and induces apoptosis via regulation of BCR/ABL1 protein. Exp Cell Res. 2013 May 1;319(8):1094-101.
REF 7 Decreased microRNA-30a levels are associated with enhanced ABL1 and BCR-ABL1 expression in chronic myeloid leukemia. Leuk Res. 2013 Mar;37(3):349-56.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.