Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T63609 Target Info
Target Name Adenylate cyclase type 1 (ADCY1)
Synonyms Ca(2+)/calmodulin-activated adenylyl cyclase; Adenylyl cyclase 1; Adenylate cyclase type I; ATP pyrophosphate-lyase 1
Target Type Successful Target
Gene Name ADCY1
Biochemical Class Phosphorus-oxygen lyase
UniProt ID
Q08828
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-212-3p miRNA Info
miRNA Mature AC
MIMAT0000269
Sequence uaacagucuccagucacggcc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [1]
Representative Target(s) Regulated by This miRNA Acetylcholinesterase (AChE) Target Info
ACES_HUMAN
Adenylate cyclase type 1 (ADCY1) Target Info
ADCY1_HUMAN
References  Top
REF 1 SOX11 identified by target gene evaluation of miRNAs differentially expressed in focal and non-focal brain tissue of therapy-resistant epilepsy patients. Neurobiol Dis. 2015 May;77:127-40.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.