Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T63966 Target Info
Target Name Vascular endothelial growth factor receptor 1 (FLT-1)
Synonyms Vascular permeability factor receptor; VEGFR1; VEGFR-1; VEGF-1 receptor; Tyrosine-protein kinase receptor FLT; Tyrosine-protein kinase FRT; Fms-like tyrosine kinase 1; FRT; FLT
Target Type Successful Target
Gene Name FLT1
Biochemical Class Kinase
UniProt ID
P17948
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-200b-3p miRNA Info
miRNA Mature AC
MIMAT0000318
Sequence uaauacugccugguaaugauga
miRNA Species Homo sapiens
Regulation Mechanism Direct targets of miR-200b are VEGF and its receptors, Flt1 and KDR, which play a pivotal role in VEGF signaling. [1]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [1]
2 Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-200c-3p miRNA Info
miRNA Mature AC
MIMAT0000617
Sequence uaauacugccggguaaugaugga
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-200c results in the negative regulation of its gene target FLT1, which in turn upregulates E-cadherin and downregulates vimentin expression to facilitate gain of epithelial characteristics that are required for mesenchymal- to-epithelial transition (MET) behaviour in CRC cells. [3]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [3]
2 Luciferase Reporter Assay; Western Blot [4]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-100-5p miRNA Info
miRNA Mature AC
MIMAT0000098
Sequence aacccguagauccgaacuugug
miRNA Species Homo sapiens
Regulation Mechanism miR-10 directly targets fms-related tyrosine kinase 1 (FLT1). [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [6]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
References  Top
REF 1 Regulation of vascular endothelial growth factor signaling by miR-200b. Mol Cells. 2011 Jul;32(1):77-82.
REF 2 Differential expression of microRNAs in retinal vasculopathy caused by selective Mler cell disruption. Sci Rep. 2016 Jul 4;6:28993.
REF 3 MicroRNA-200c modulates epithelial-to-mesenchymal transition (EMT) in human colorectal cancer metastasis. Gut. 2013 Sep;62(9):1315-26.
REF 4 Endometrial miR-200c is altered during transformation into cancerous states and targets the expression of ZEBs, VEGFA, FLT1, IKK, KLF9, and FBLN5. Reprod Sci. 2012 Aug;19(8):786-96.
REF 5 MicroRNA-10 regulates the angiogenic behavior of zebrafish and human endothelial cells by promoting vascular endothelial growth factor signaling. Circ Res. 2012 Nov 9;111(11):1421-33.
REF 6 Endothelial enriched microRNAs regulate angiotensin II-induced endothelial inflammation and migration. Atherosclerosis. 2011 Apr;215(2):286-93.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.