miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-100-5p
miRNA Stemloop AC MI0000102
miRNA Stemloop ID hsa-mir-100
Sequence aacccguagauccgaacuugug
TTD Target(s) Regulated by This miRNA Estrogen receptor (ESR) Successful Target Target Info [1]
Serine/threonine-protein kinase mTOR (mTOR) Successful Target Target Info [2]
Insulin-like growth factor I receptor (IGF1R) Successful Target Target Info [2]
Fibroblast growth factor receptor 3 (FGFR3) Successful Target Target Info [3]
Matrix metalloproteinase-13 (MMP-13) Clinical trial Target Target Info [3]
RAC-alpha serine/threonine-protein kinase (AKT1) Successful Target Target Info [4]
Vascular endothelial growth factor receptor 1 (FLT-1) Successful Target Target Info [5]
Polo-like kinase 1 (PLK1) Clinical trial Target Target Info [6]
ATM serine/threonine kinase (ATM) Clinical trial Target Target Info [7]
Insulin-like growth factor-II (IGF2) Clinical trial Target Target Info [8]
C-X-C chemokine receptor type 7 (ACKR3) Preclinical Target Target Info [9]
Bone morphogenetic protein receptor (BMPR2) Literature-reported Target Target Info [10]
FK506-binding protein 5 (FKBP5) Literature-reported Target Target Info [11]
Cysteine-rich angiogenic inducer 61 (CYR61) Literature-reported Target Target Info [12]
Protein(s) Regulated by This miRNA CTD small phosphatase-like protein Regulated Protein
CTDSL_HUMAN
[13]
E3 SUMO-protein ligase EGR2 Regulated Protein
EGR2_HUMAN
[3]
E3 ubiquitin-protein ligase RNF144B Regulated Protein
R144B_HUMAN
[15]
E3 ubiquitin-protein ligase ZNRF2 Regulated Protein
ZNRF2_HUMAN
[16]
Grainyhead-like protein 1 homolog Regulated Protein
GRHL1_HUMAN
[17]
Heparan sulfate glucosamine 3-O-sulfotransferase 2 Regulated Protein
HS3S2_HUMAN
[18]
Homeobox protein Hox-A1 Regulated Protein
HXA1_HUMAN
[19]
Nuclear receptor corepressor 2 Regulated Protein
NCOR2_HUMAN
[20]
Ras-related protein Rap-1b Regulated Protein
RAP1B_HUMAN
[21]
Serine/threonine-protein phosphatase PP1-beta catalytic subunit Regulated Protein
PP1B_HUMAN
[17]
SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 5 Regulated Protein
SMCA5_HUMAN
[22]
THAP domain-containing protein 2 Regulated Protein
THAP2_HUMAN
[23]
Zinc finger and BTB domain-containing protein 7A Regulated Protein
ZBT7A_HUMAN
[24]
Zinc finger protein 215 Regulated Protein
ZN215_HUMAN
[23]
References
REF 1 Significance of microRNA targeted estrogen receptor in male fertility. Iran J Basic Med Sci. 2014 Feb;17(2):81-6.
REF 2 Regulation of insulin-like growth factor-mammalian target of rapamycin signaling by microRNA in childhood adrenocortical tumors. Cancer Res. 2010 Jun 1;70(11):4666-75.
REF 3 Decreased expression of miR-125b and miR-100 in oral cancer cells contributes to malignancy. Genes Chromosomes Cancer. 2009 Jul;48(7):569-82.
REF 4 MicroRNA-99 family targets AKT/mTOR signaling pathway in dermal wound healing. PLoS One. 2013 May 28;8(5):e64434.
REF 5 MicroRNA-10 regulates the angiogenic behavior of zebrafish and human endothelial cells by promoting vascular endothelial growth factor signaling. Circ Res. 2012 Nov 9;111(11):1421-33.
REF 6 Significance of Plk1 regulation by miR-100 in human nasopharyngeal cancer. Int J Cancer. 2010 May 1;126(9):2036-48.
REF 7 Over-expression of miR-100 is responsible for the low-expression of ATM in the human glioma cell line: M059J. DNA Repair (Amst). 2010 Nov 10;9(11):1170-5.
REF 8 miR-100 suppresses IGF2 and inhibits breast tumorigenesis by interfering with proliferation and survival signaling. Oncogene. 2013 Jul 4;32(27):3306-10.
REF 9 miR-100 suppresses the proliferation and tumor growth of esophageal squamous cancer cells via targeting CXCR7. Oncol Rep. 2016 Jun;35(6):3453-9.
REF 10 MicroRNA-100 regulates osteogenic differentiation of human adipose-derived mesenchymal stem cells by targeting BMPR2. FEBS Lett. 2012 Jul 30;586(16):2375-81.
REF 11 MicroRNA-100/99a, deregulated in acute lymphoblastic leukaemia, suppress proliferation and promote apoptosis by regulating the FKBP51 and IGF1R/mTOR signalling pathways. Br J Cancer. 2013 Oct 15;109(8):2189-98.
REF 12 MicroRNA-100 inhibits osteosarcoma cell proliferation by targeting Cyr61. Tumour Biol. 2014 Feb;35(2):1095-100.
REF 13 MiR-100 regulates cell differentiation and survival by targeting RBSP3, a phosphatase-like tumor suppressor in acute myeloid leukemia.Oncogene. 2012 Jan 5;31(1):80-92.
REF 14 Decreased expression of miR-125b and miR-100 in oral cancer cells contributes to malignancy. Genes Chromosomes Cancer. 2009 Jul;48(7):569-82.
REF 15 miR-100 antagonism triggers apoptosis by inhibiting ubiquitination-mediated p53 degradation.Oncogene. 2017 Feb 23;36(8):1023-1037.
REF 16 MicroRNA-100 suppresses human osteosarcoma cell proliferation and chemo-resistance via ZNRF2.Oncotarget. 2017 May 23;8(21):34678-34686.
REF 17 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 18 The role of miR-100-mediated Notch pathway in apoptosis of gastric tumor cells.Cell Signal. 2015 Jun;27(6):1087-101.
REF 19 Downregulation of HOXA1 gene affects small cell lung cancer cell survival and chemoresistance under the regulation of miR-100.Eur J Cancer. 2014 May;50(8):1541-54.
REF 20 microRNA-100 targets SMRT/NCOR2, reduces proliferation, and improves survival in glioblastoma animal models.PLoS One. 2013 Nov 14;8(11):e80865.
REF 21 MicroRNA-100 regulates SW620 colorectal cancer cell proliferation and invasion by targeting RAP1B.Oncol Rep. 2014 May;31(5):2055-62.
REF 22 The miR-99 family regulates the DNA damage response through its target SNF2H.Oncogene. 2013 Feb 28;32(9):1164-72.
REF 23 MicroRNA 100: a context dependent miRNA in prostate cancer. Clinics (Sao Paulo). 2013 Jun;68(6):797-802.
REF 24 C/EBP-induced miR-100 expression suppresses tumor metastasis and growth by targeting ZBTB7A in gastric cancer.Cancer Lett. 2015 Dec 28;369(2):376-85.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.