Content Navigation
( All
None )
| Target General Information |
Top |
| Target ID |
T65116 |
Target Info
|
| Target Name |
Ecto-5'-nucleotidase (CD73) |
| Synonyms |
NT5; CD73 antigen; 5'-nucleotidase; 5'-NT |
| Target Type |
Clinical trial Target |
| Gene Name |
NT5E |
| Biochemical Class |
Phosphoric monoester hydrolase |
| UniProt ID |
|
| The microRNAs (miRNAs) Regulating This Target |
Top |
| miRNA Mature ID |
hsa-miR-30a-5p |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
uguaaacauccucgacuggaag
|
| miRNA Species |
Homo sapiens |
| Evidence Score (E-score) |
2 |
+ |
| 1 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[1] |
| 2 |
Proteomics |
[2] |
| Representative Target(s) Regulated by This miRNA |
Beclin-1 (BECN1)
|
Target Info
|
|
|
Brain-derived neurotrophic factor (BDNF)
|
Target Info
|
|
| miRNA Mature ID |
hsa-miR-422a |
miRNA Info
|
| miRNA Mature AC |
|
| Sequence |
acuggacuuagggucagaaggc
|
| miRNA Species |
Homo sapiens |
| Regulation Mechanism |
miR-422a directly impacts the mRNA and protein level of CD73, as well as its enzymatic activity. |
[3] |
| Evidence Score (E-score) |
1 |
+ |
| 1 |
Immunohistochemistry |
[3] |
| Representative Target(s) Regulated by This miRNA |
Ecto-5'-nucleotidase (CD73)
|
Target Info
|
|
|
Forkhead box protein Q1 (FOXQ1)
|
Target Info
|
|
| References |
Top |
| REF 1 |
CD73/NT5E is a target of miR-30a-5p and plays an important role in the pathogenesis of non-small cell lung cancer. Mol Cancer. 2017 Feb 3;16(1):34.
|
| REF 2 |
Widespread changes in protein synthesis induced by microRNAs.Nature. 2008 Sep 4;455(7209):58-63.
|
| REF 3 |
MiR-422a promotes loco-regional recurrence by targeting NT5E/CD73 in head and neck squamous cell carcinoma. Oncotarget. 2016 Jul 12;7(28):44023-44038.
|
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.
